Rroxscaffold_3G00246630

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001848
Physical Location & Seq
Reverse (-)
39780716 .. 39797049
16334 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00246630.1

Sequence Viewer

Length: 348 bp
ATGGCTCCAAAGATGAGGTGGACAAGAAGTAAGAGATTGTTACAGGAGTATGAAGATGAAAATCATAATGCTGAAAGGGAAGTCCAAGAAATATCTAATGACCAGAATGTAATTGGTAATATATCTGAATCTGGAACCGCAGTTTCTGGTAGGGGCGATGACCATCAAATTCATCCAAGATCAAGGCATGCATCTGAGTTGAGGATGAGAAAAAGGGACCGACATTTAGACACTCAGTACAGTGCCAGGAATGATGATGCCAGTCGATTTCAACACTGTCGCAAGAGATTTATAAGCAGTCAACAAAACACTGCTGCAATTTCAAATCAAAGTGCAAGAGATTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

13.43

Weight (kDa)

9.42

Isoelectric Point (pI)

65.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 293, 346
AciI CCGC 1 cut(s) 138
AcsI RAATTY 1 cut(s) 168
AfaI GTAC 1 cut(s) 239
AgsI TTSAA 2 cut(s) 272, 324
AjnI CCWGG 1 cut(s) 245
AlwNI CAGNNNCTG 1 cut(s) 146
ApeKI GCWGC 1 cut(s) 314
ApoI RAATTY 1 cut(s) 168
AspS9I GGNCC 1 cut(s) 217
AvaII GGWCC 1 cut(s) 217
BbvI GCAGC 1 cut(s) 301
BccI CCATC 1 cut(s) 171
BciT130I CCWGG 1 cut(s) 247
BisI GCNGC 1 cut(s) 315
BlsI GCNGC 1 cut(s) 316
Bme1390I CCNGG 1 cut(s) 247
Bme18I GGWCC 1 cut(s) 217
BmgT120I GGNCC 1 cut(s) 217
BmiI GGNNCC 3 cut(s) 6, 136, 218
BmrFI CCNGG 1 cut(s) 247
BmsI GCATC 2 cut(s) 200, 247
BsaBI GATNNNNATC 2 cut(s) 60, 162
Bse1I ACTGG 1 cut(s) 261
Bse8I GATNNNNATC 2 cut(s) 60, 162
BseBI CCWGG 1 cut(s) 247
BseGI GGATG 2 cut(s) 172, 210
BseJI GATNNNNATC 2 cut(s) 60, 162
BseMII CTCAG 2 cut(s) 186, 248
BseNI ACTGG 1 cut(s) 261
BseXI GCAGC 1 cut(s) 301
BslFI GGGAC 1 cut(s) 230
BsmFI GGGAC 1 cut(s) 230
Bsp143I GATC 1 cut(s) 179
BspACI CCGC 1 cut(s) 138
BspCNI CTCAG 2 cut(s) 187, 247
BspLI GGNNCC 3 cut(s) 6, 136, 218
BsrI ACTGG 1 cut(s) 261
BssMI GATC 1 cut(s) 179
Bst2UI CCWGG 1 cut(s) 247
Bst4CI ACNGT 2 cut(s) 242, 278
BstC8I GCNNGC 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 195, 234
BstF5I GGATG 2 cut(s) 172, 210
BstKTI GATC 1 cut(s) 182
BstMBI GATC 1 cut(s) 179
BstNI CCWGG 1 cut(s) 247
BstNSI RCATGY 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 245
BstV1I GCAGC 1 cut(s) 301
BtgZI GCGATG 1 cut(s) 171
BtsCI GGATG 2 cut(s) 172, 210
BtsI GCAGTG 1 cut(s) 309
BtsIMutI CAGTG 3 cut(s) 247, 274, 309
Cac8I GCNNGC 1 cut(s) 189
CaiI CAGNNNCTG 1 cut(s) 146
Cfr13I GGNCC 1 cut(s) 217
Csp6I GTAC 1 cut(s) 238
CviAII CATG 1 cut(s) 188
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 1 cut(s) 238
DdeI CTNAG 2 cut(s) 195, 234
DpnI GATC 1 cut(s) 181
DpnII GATC 1 cut(s) 179
Eco47I GGWCC 1 cut(s) 217
EcoRII CCWGG 1 cut(s) 245
EcoT22I ATGCAT 1 cut(s) 193
FaeI CATG 1 cut(s) 191
FaiI YATR 6 cut(s) 51, 66, 122, 189, 293, 346
FaqI GGGAC 1 cut(s) 230
FatI CATG 1 cut(s) 187
Fnu4HI GCNGC 1 cut(s) 315
FokI GGATG 2 cut(s) 159, 217
Fsp4HI GCNGC 1 cut(s) 315
GluI GCNGC 1 cut(s) 315
Hin1II CATG 1 cut(s) 191
HincII GTYRAC 1 cut(s) 302
HindII GTYRAC 1 cut(s) 302
HinfI GANTC 1 cut(s) 128
Hpy166II GTNNAC 2 cut(s) 21, 302
Hpy188I TCNGA 2 cut(s) 127, 196
Hpy188III TCNNGA 1 cut(s) 132
Hpy8I GTNNAC 2 cut(s) 21, 302
HpyCH4III ACNGT 2 cut(s) 242, 278
HpyCH4V TGCA 3 cut(s) 191, 317, 335
HpyF3I CTNAG 2 cut(s) 195, 234
Hsp92II CATG 1 cut(s) 191
Kzo9I GATC 1 cut(s) 179
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 7 cut(s) 29, 116, 117, 132, 232, 259, 274
Lsp1109I GCAGC 1 cut(s) 301
LweI GCATC 2 cut(s) 200, 247
MaeIII GTNAC 1 cut(s) 39
MalI GATC 1 cut(s) 181
MboI GATC 1 cut(s) 179
MboII GAAGA 1 cut(s) 65
MluCI AATT 3 cut(s) 111, 168, 318
MnlI CCTC 2 cut(s) 9, 195
Mph1103I ATGCAT 1 cut(s) 193
MspR9I CCNGG 1 cut(s) 247
MvaI CCWGG 1 cut(s) 247
NdeII GATC 1 cut(s) 179
NlaIII CATG 1 cut(s) 191
NlaIV GGNNCC 3 cut(s) 6, 136, 218
NsiI ATGCAT 1 cut(s) 193
NspI RCATGY 1 cut(s) 191
PaeI GCATGC 1 cut(s) 191
PfeI GAWTC 1 cut(s) 128
PkrI GCNGC 1 cut(s) 316
PsiI TTATAA 2 cut(s) 293, 346
Psp6I CCWGG 1 cut(s) 245
PspGI CCWGG 1 cut(s) 245
PspN4I GGNNCC 3 cut(s) 6, 136, 218
PspPI GGNCC 1 cut(s) 217
PstNI CAGNNNCTG 1 cut(s) 146
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
SatI GCNGC 1 cut(s) 315
Sau3AI GATC 1 cut(s) 179
Sau96I GGNCC 1 cut(s) 217
ScrFI CCNGG 1 cut(s) 247
SetI ASST 1 cut(s) 20
SfaNI GCATC 2 cut(s) 200, 247
SinI GGWCC 1 cut(s) 217
SphI GCATGC 1 cut(s) 191
Sse9I AATT 3 cut(s) 111, 168, 318
SsiI CCGC 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 245
TaaI ACNGT 2 cut(s) 242, 278
TaqI TCGA 1 cut(s) 265
TaqII GACCGA 1 cut(s) 234
TasI AATT 3 cut(s) 111, 168, 318
TatI WGTACW 1 cut(s) 237
TfiI GAWTC 1 cut(s) 128
TscAI CASTG 3 cut(s) 247, 281, 316
TseI GCWGC 1 cut(s) 314
TspDTI ATGAA 3 cut(s) 66, 72, 161
TspRI CASTG 3 cut(s) 247, 281, 316
VpaK11BI GGWCC 1 cut(s) 217
XapI RAATTY 1 cut(s) 168
XceI RCATGY 1 cut(s) 191
XcmI CCANNNNNNNNNTGG 2 cut(s) 15, 110
Zsp2I ATGCAT 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.