RchiOBHm_Chr1g0351231

Basic blue protein-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
44474654 .. 44475098
445 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57702

Sequence Viewer

Length: 282 bp
ATGGCACGAGTCACTACTGCTCTTGTTGTCATTGCCTTTTCCGTCGTTTTTCCGAGCATGGTTCTGGCAACAGAATATGTTGTCGGAGATGATCTAGGCTGGGACGGAACTGCTAATTACCAAGCTTGGGCTGATGACCATGCTTTCCATGTTGGAGATGTCTTAAGTGTGTACGACAGTGGCAATGACGCATTAACCTTGAGCGTTGCTGGAACCTACTACTTCTTATGTGGATATCACTGCGATACACTTCAGCAGACGTTCTTTATCGTTGTGGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.09

Weight (kDa)

4.05

Isoelectric Point (pI)

21.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 236
AfaI GTAC 1 cut(s) 173
AfiI CCNNNNNNNGG 1 cut(s) 127
AflII CTTAAG 1 cut(s) 163
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
BauI CACGAG 1 cut(s) 6
BfaI CTAG 2 cut(s) 95, 280
BfrI CTTAAG 1 cut(s) 163
BmiI GGNNCC 1 cut(s) 214
BpuEI CTTGAG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 1 cut(s) 127
Bse3DI GCAATG 2 cut(s) 30, 190
BseLI CCNNNNNNNGG 1 cut(s) 127
BseMI GCAATG 2 cut(s) 30, 190
BseYI CCCAGC 1 cut(s) 99
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 214
BspTI CTTAAG 1 cut(s) 163
BsrDI GCAATG 2 cut(s) 30, 190
BssMI GATC 1 cut(s) 91
BssSI CACGAG 1 cut(s) 6
Bst2BI CACGAG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 179
BstAFI CTTAAG 1 cut(s) 163
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BtsI GCAGTG 1 cut(s) 238
BtsIMutI CAGTG 2 cut(s) 184, 238
CseI GACGC 1 cut(s) 197
Csp6I GTAC 1 cut(s) 172
CviAII CATG 3 cut(s) 58, 140, 149
CviJI RGCY 4 cut(s) 99, 125, 131, 279
CviKI_1 RGCY 4 cut(s) 99, 125, 131, 279
CviQI GTAC 1 cut(s) 172
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco32I GATATC 1 cut(s) 236
Eco57I CTGAAG 1 cut(s) 236
EcoRV GATATC 1 cut(s) 236
FaeI CATG 3 cut(s) 61, 143, 152
FaiI YATR 5 cut(s) 59, 78, 141, 150, 229
FaqI GGGAC 1 cut(s) 116
FatI CATG 3 cut(s) 57, 139, 148
FspBI CTAG 2 cut(s) 95, 280
GsaI CCCAGC 1 cut(s) 103
HgaI GACGC 1 cut(s) 197
Hin1II CATG 3 cut(s) 61, 143, 152
HindIII AAGCTT 1 cut(s) 123
HinfI GANTC 1 cut(s) 9
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 2 cut(s) 54, 86
Hpy8I GTNNAC 1 cut(s) 172
Hpy99I CGWCG 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4IV ACGT 1 cut(s) 260
HpySE526I ACGT 1 cut(s) 260
Hsp92II CATG 3 cut(s) 61, 143, 152
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 3 cut(s) 50, 85, 195
MaeI CTAG 2 cut(s) 95, 280
MaeII ACGT 1 cut(s) 260
MaeIII GTNAC 1 cut(s) 10
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 1 cut(s) 115
MlyI GAGTC 1 cut(s) 18
MmeI TCCRAC 2 cut(s) 64, 133
MseI TTAA 2 cut(s) 164, 194
MspCI CTTAAG 1 cut(s) 163
NdeII GATC 1 cut(s) 91
NlaIII CATG 3 cut(s) 61, 143, 152
NlaIV GGNNCC 1 cut(s) 214
NmuCI GTSAC 1 cut(s) 10
PleI GAGTC 1 cut(s) 17
PpsI GAGTC 1 cut(s) 17
PspFI CCCAGC 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 214
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
SaqAI TTAA 2 cut(s) 164, 194
Sau3AI GATC 1 cut(s) 91
SchI GAGTC 1 cut(s) 18
SetI ASST 4 cut(s) 127, 200, 218, 263
SmlI CTYRAG 2 cut(s) 163, 199
SmoI CTYRAG 2 cut(s) 163, 199
Sse9I AATT 1 cut(s) 115
SspMI CTAG 2 cut(s) 95, 280
TaaI ACNGT 1 cut(s) 179
TaiI ACGT 1 cut(s) 263
TasI AATT 1 cut(s) 115
Tru1I TTAA 2 cut(s) 164, 194
Tru9I TTAA 2 cut(s) 164, 194
TscAI CASTG 2 cut(s) 184, 245
TseFI GTSAC 1 cut(s) 10
Tsp45I GTSAC 1 cut(s) 10
TspGWI ACGGA 2 cut(s) 31, 120
TspRI CASTG 2 cut(s) 184, 245
Vha464I CTTAAG 1 cut(s) 163
XspI CTAG 2 cut(s) 95, 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.