Rh1DG229100

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0001155
Physical Location & Seq
Reverse (-)
44084949 .. 44085356
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG229100.1

Sequence Viewer

Length: 315 bp
ATGGTTTTGTCAAAACAGTATGTTGTTGGAGATGATGAAGGCTGGGATGGTAATGTTGATTACCAAGCGTGGGCAGATGACAAAACTTTCAAACTTGGAGATGTTTTAATATTCAAATACGATGCTGGTAGCCATAACGTTGCTCAAGCGTTTAATGCTGATGGCTATGACAGTTGTACTTCATCACCAGAATTGGGTGTGTACACCAGTGGCAATGACGCTTTAACTTTCAATCTTGTTGGGAGCTATTATTTCTTATGTGACTATCATTGTGACTCTGATCAACACAAAGTTATGATCAATATTGTTACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

104

Amino Acids

11.56

Weight (kDa)

4.12

Isoelectric Point (pI)

35.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 15 - 94 3.5e-20 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 138
AfaI GTAC 2 cut(s) 178, 203
AfiI CCNNNNNNNGG 2 cut(s) 70, 194
AgsI TTSAA 3 cut(s) 91, 115, 232
AluBI AGCT 1 cut(s) 246
AluI AGCT 1 cut(s) 246
AsuHPI GGTGA 1 cut(s) 177
BccI CCATC 2 cut(s) 41, 155
BclI TGATCA 2 cut(s) 280, 297
BmsI GCATC 1 cut(s) 112
BpuEI CTTGAG 1 cut(s) 129
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 194
Bse1I ACTGG 1 cut(s) 207
Bse3DI GCAATG 1 cut(s) 220
BseGI GGATG 1 cut(s) 52
BseLI CCNNNNNNNGG 2 cut(s) 70, 194
BseMI GCAATG 1 cut(s) 220
BseNI ACTGG 1 cut(s) 207
BseYI CCCAGC 1 cut(s) 42
BslI CCNNNNNNNGG 2 cut(s) 70, 194
Bsp1407I TGTACA 1 cut(s) 201
Bsp143I GATC 2 cut(s) 280, 297
BsrDI GCAATG 1 cut(s) 220
BsrGI TGTACA 1 cut(s) 201
BsrI ACTGG 1 cut(s) 207
BssMI GATC 2 cut(s) 280, 297
Bst4CI ACNGT 2 cut(s) 18, 173
BstAUI TGTACA 1 cut(s) 201
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 2 cut(s) 283, 300
BstMBI GATC 2 cut(s) 280, 297
BstMWI GCNNNNNNNGC 1 cut(s) 155
BtsCI GGATG 1 cut(s) 52
BtsIMutI CAGTG 1 cut(s) 214
CseI GACGC 1 cut(s) 227
Csp6I GTAC 2 cut(s) 177, 202
CviJI RGCY 4 cut(s) 42, 132, 165, 246
CviKI_1 RGCY 4 cut(s) 42, 132, 165, 246
CviQI GTAC 2 cut(s) 177, 202
DpnI GATC 2 cut(s) 282, 299
DpnII GATC 2 cut(s) 280, 297
FaiI YATR 6 cut(s) 21, 135, 168, 259, 296, 313
FbaI TGATCA 2 cut(s) 280, 297
FokI GGATG 1 cut(s) 59
GsaI CCCAGC 1 cut(s) 46
HgaI GACGC 1 cut(s) 227
HinfI GANTC 1 cut(s) 275
HphI GGTGA 1 cut(s) 177
Hpy166II GTNNAC 2 cut(s) 202, 204
Hpy188I TCNGA 1 cut(s) 280
Hpy8I GTNNAC 2 cut(s) 202, 204
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 2 cut(s) 18, 173
HpyCH4IV ACGT 1 cut(s) 138
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 138
Ksp22I TGATCA 2 cut(s) 280, 297
Kzo9I GATC 2 cut(s) 280, 297
LmnI GCTCC 1 cut(s) 243
LpnPI CCDG 4 cut(s) 28, 111, 201, 220
LweI GCATC 1 cut(s) 112
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 3 cut(s) 260, 272, 307
MalI GATC 2 cut(s) 282, 299
MboI GATC 2 cut(s) 280, 297
MluCI AATT 1 cut(s) 191
MlyI GAGTC 1 cut(s) 269
MmeI TCCRAC 1 cut(s) 7
MseI TTAA 3 cut(s) 107, 153, 224
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 2 cut(s) 280, 297
NmuCI GTSAC 2 cut(s) 260, 272
PleI GAGTC 1 cut(s) 269
PpsI GAGTC 1 cut(s) 269
Psp1406I AACGTT 1 cut(s) 138
PspFI CCCAGC 1 cut(s) 42
RsaI GTAC 2 cut(s) 178, 203
RsaNI GTAC 2 cut(s) 177, 202
SaqAI TTAA 3 cut(s) 107, 153, 224
Sau3AI GATC 2 cut(s) 280, 297
SchI GAGTC 1 cut(s) 269
SetI ASST 2 cut(s) 141, 248
SfaNI GCATC 1 cut(s) 112
SgeI CNNG 9 cut(s) 55, 77, 81, 107, 138, 158, 200, 219, 248
SmlI CTYRAG 1 cut(s) 144
SmoI CTYRAG 1 cut(s) 144
Sse9I AATT 1 cut(s) 191
SspI AATATT 2 cut(s) 111, 304
TaaI ACNGT 2 cut(s) 18, 173
TaiI ACGT 1 cut(s) 141
TasI AATT 1 cut(s) 191
TatI WGTACW 2 cut(s) 176, 201
Tru1I TTAA 3 cut(s) 107, 153, 224
Tru9I TTAA 3 cut(s) 107, 153, 224
TscAI CASTG 1 cut(s) 214
TseFI GTSAC 2 cut(s) 260, 272
Tsp45I GTSAC 2 cut(s) 260, 272
TspDTI ATGAA 2 cut(s) 51, 171
TspRI CASTG 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.