Rmu_sc0003271.1_g000014

Basic blue protein-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003271.1
Physical Location & Seq
Forward (+)
68602 .. 69046
445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003271.1_g000014.1.cds

Sequence Viewer

Length: 351 bp
atggcacgagtcactactgctcttgttgtcattgccttttccgtcatttttccgagcatggttctggcaacagaatatgttgtcggagatgatctaggctgggacggaactgctaattaccaagcttgggctgatgaccatgctttccatgttggagatgtcttaaatgaacacaacgttcttttagtggctgatcatctagggattgatacttgtgtttcatctccaagcttaggtgtgtacgacagtggccattacgcattaaccttgagcgttgctggaacctactacttcttatgtggatatcactgcgatacacttcagcagaagttctttatcgttgtggactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.65

Weight (kDa)

4.38

Isoelectric Point (pI)

29.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 177
AcoI YGGCCR 1 cut(s) 250
AcuI CTGAAG 1 cut(s) 305
AfaI GTAC 1 cut(s) 242
AfiI CCNNNNNNNGG 2 cut(s) 127, 233
AluBI AGCT 2 cut(s) 125, 231
AluI AGCT 2 cut(s) 125, 231
AoxI GGCC 1 cut(s) 250
BaeI ACNNNNGTAYC 2 cut(s) 201, 234
BalI TGGCCA 1 cut(s) 252
BauI CACGAG 1 cut(s) 6
BclI TGATCA 1 cut(s) 193
BfaI CTAG 3 cut(s) 95, 200, 349
BmiI GGNNCC 1 cut(s) 283
Bpu10I CCTNAGC 1 cut(s) 232
BpuEI CTTGAG 1 cut(s) 289
Bsc4I CCNNNNNNNGG 2 cut(s) 127, 233
Bse3DI GCAATG 1 cut(s) 30
BseLI CCNNNNNNNGG 2 cut(s) 127, 233
BseMI GCAATG 1 cut(s) 30
BseYI CCCAGC 1 cut(s) 99
BshFI GGCC 1 cut(s) 252
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 2 cut(s) 127, 233
BsmFI GGGAC 1 cut(s) 116
BsnI GGCC 1 cut(s) 252
Bsp143I GATC 2 cut(s) 91, 193
BspANI GGCC 1 cut(s) 252
BspLI GGNNCC 1 cut(s) 283
BsrDI GCAATG 1 cut(s) 30
BssMI GATC 2 cut(s) 91, 193
BssSI CACGAG 1 cut(s) 6
Bst2BI CACGAG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 248
BstDEI CTNAG 1 cut(s) 232
BstKTI GATC 2 cut(s) 94, 196
BstMBI GATC 2 cut(s) 91, 193
BsuRI GGCC 1 cut(s) 252
BtsI GCAGTG 1 cut(s) 307
BtsIMutI CAGTG 2 cut(s) 253, 307
Csp6I GTAC 1 cut(s) 241
CviAII CATG 3 cut(s) 58, 140, 149
CviJI RGCY 6 cut(s) 99, 125, 131, 191, 231, 252
CviKI_1 RGCY 6 cut(s) 99, 125, 131, 191, 231, 252
CviQI GTAC 1 cut(s) 241
DdeI CTNAG 1 cut(s) 232
DpnI GATC 2 cut(s) 93, 195
DpnII GATC 2 cut(s) 91, 193
EaeI YGGCCR 1 cut(s) 250
Eco32I GATATC 1 cut(s) 305
Eco57I CTGAAG 1 cut(s) 305
EcoRV GATATC 1 cut(s) 305
FaeI CATG 3 cut(s) 61, 143, 152
FaiI YATR 5 cut(s) 59, 78, 141, 150, 298
FaqI GGGAC 1 cut(s) 116
FatI CATG 3 cut(s) 57, 139, 148
FbaI TGATCA 1 cut(s) 193
FspBI CTAG 3 cut(s) 95, 200, 349
GsaI CCCAGC 1 cut(s) 103
HaeIII GGCC 1 cut(s) 252
Hin1II CATG 3 cut(s) 61, 143, 152
HindIII AAGCTT 2 cut(s) 123, 229
HinfI GANTC 1 cut(s) 9
Hpy166II GTNNAC 2 cut(s) 241, 346
Hpy188I TCNGA 2 cut(s) 54, 86
Hpy8I GTNNAC 2 cut(s) 241, 346
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4IV ACGT 1 cut(s) 177
HpyF3I CTNAG 1 cut(s) 232
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 3 cut(s) 61, 143, 152
Ksp22I TGATCA 1 cut(s) 193
Kzo9I GATC 2 cut(s) 91, 193
LpnPI CCDG 3 cut(s) 50, 85, 264
MaeI CTAG 3 cut(s) 95, 200, 349
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 10
MalI GATC 2 cut(s) 93, 195
MboI GATC 2 cut(s) 91, 193
MlsI TGGCCA 1 cut(s) 252
MluCI AATT 1 cut(s) 115
MluNI TGGCCA 1 cut(s) 252
MlyI GAGTC 1 cut(s) 18
MmeI TCCRAC 2 cut(s) 64, 133
Mox20I TGGCCA 1 cut(s) 252
MscI TGGCCA 1 cut(s) 252
MseI TTAA 2 cut(s) 164, 263
Msp20I TGGCCA 1 cut(s) 252
NdeII GATC 2 cut(s) 91, 193
NlaIII CATG 3 cut(s) 61, 143, 152
NlaIV GGNNCC 1 cut(s) 283
NmuCI GTSAC 1 cut(s) 10
PleI GAGTC 1 cut(s) 17
PpsI GAGTC 1 cut(s) 17
Psp1406I AACGTT 1 cut(s) 177
PspFI CCCAGC 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 283
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
SaqAI TTAA 2 cut(s) 164, 263
Sau3AI GATC 2 cut(s) 91, 193
SchI GAGTC 1 cut(s) 18
SetI ASST 6 cut(s) 127, 180, 233, 238, 269, 287
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
Sse9I AATT 1 cut(s) 115
SspMI CTAG 3 cut(s) 95, 200, 349
TaaI ACNGT 1 cut(s) 248
TaiI ACGT 1 cut(s) 180
TasI AATT 1 cut(s) 115
Tru1I TTAA 2 cut(s) 164, 263
Tru9I TTAA 2 cut(s) 164, 263
TscAI CASTG 2 cut(s) 253, 314
TseFI GTSAC 1 cut(s) 10
Tsp45I GTSAC 1 cut(s) 10
TspDTI ATGAA 2 cut(s) 183, 210
TspGWI ACGGA 2 cut(s) 31, 120
TspRI CASTG 2 cut(s) 253, 314
XspI CTAG 3 cut(s) 95, 200, 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.