Rw1G020670

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0001155
Physical Location & Seq
Forward (+)
44341734 .. 44342187
454 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G020670.1

Sequence Viewer

Length: 348 bp
ATGATCTCACATGCCGTCTTCGTTGTTTTTCCGAGCATGGTTTTGGCGACACAATATGTTGTTGGAGATGATTTAGGCTGGAATGGTGATGCTGATTACGAGGGTTGGGTTGCTGACAAAACTTTCTTTGTTGGAGATGTTTTAGTTTTCAATTACGTTGCAACTGACCACAACGTTGTTATAGCTACTAATGGTGACAATTATGACAATTGTGTTGCATCTCCAAACTTTGGTGTGTACGATAGTGGGAATGATGCAATAACATTGAATGAAGCTGGAACTTACTACTTCTTATGTTCATATCATTGCGACTATCTGCAGCAGAAAGTTATGGTCACTGTGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

115

Amino Acids

12.72

Weight (kDa)

4.05

Isoelectric Point (pI)

21.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 28 - 102 1e-18 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 230
AclI AACGTT 1 cut(s) 174
AfaI GTAC 1 cut(s) 239
AfiI CCNNNNNNNGG 1 cut(s) 230
AgsI TTSAA 2 cut(s) 151, 268
AluBI AGCT 2 cut(s) 185, 275
AluI AGCT 2 cut(s) 185, 275
ApeKI GCWGC 1 cut(s) 319
AsuHPI GGTGA 2 cut(s) 98, 206
BbsI GAAGAC 1 cut(s) 10
BbvI GCAGC 1 cut(s) 331
BfaI CTAG 1 cut(s) 346
BfmI CTRYAG 1 cut(s) 317
BisI GCNGC 1 cut(s) 320
BlsI GCNGC 1 cut(s) 321
BmsI GCATC 3 cut(s) 79, 227, 244
BpiI GAAGAC 1 cut(s) 10
Bsc4I CCNNNNNNNGG 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 304
BseLI CCNNNNNNNGG 1 cut(s) 230
BseMI GCAATG 1 cut(s) 304
BseXI GCAGC 1 cut(s) 331
BslI CCNNNNNNNGG 1 cut(s) 230
Bsp143I GATC 1 cut(s) 3
BspMAI CTGCAG 1 cut(s) 321
BsrDI GCAATG 1 cut(s) 304
BssMI GATC 1 cut(s) 3
Bst4CI ACNGT 1 cut(s) 340
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNSI RCATGY 1 cut(s) 14
BstSFI CTRYAG 1 cut(s) 317
BstV1I GCAGC 1 cut(s) 331
BstV2I GAAGAC 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 336
Csp6I GTAC 1 cut(s) 238
CviAII CATG 2 cut(s) 11, 37
CviJI RGCY 3 cut(s) 78, 185, 275
CviKI_1 RGCY 3 cut(s) 78, 185, 275
CviQI GTAC 1 cut(s) 238
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
FaeI CATG 2 cut(s) 14, 40
FaiI YATR 8 cut(s) 12, 38, 57, 182, 204, 295, 301, 332
FatI CATG 2 cut(s) 10, 36
Fnu4HI GCNGC 1 cut(s) 320
Fsp4HI GCNGC 1 cut(s) 320
FspBI CTAG 1 cut(s) 346
GluI GCNGC 1 cut(s) 320
Hin1II CATG 2 cut(s) 14, 40
HphI GGTGA 2 cut(s) 98, 206
Hpy166II GTNNAC 2 cut(s) 238, 343
Hpy188I TCNGA 1 cut(s) 33
Hpy8I GTNNAC 2 cut(s) 238, 343
HpyCH4III ACNGT 1 cut(s) 340
HpyCH4IV ACGT 2 cut(s) 156, 174
HpyCH4V TGCA 4 cut(s) 161, 218, 257, 319
HpySE526I ACGT 2 cut(s) 156, 174
Hsp92II CATG 2 cut(s) 14, 40
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 64, 261
Lsp1109I GCAGC 1 cut(s) 331
LweI GCATC 3 cut(s) 79, 227, 244
MaeI CTAG 1 cut(s) 346
MaeII ACGT 2 cut(s) 156, 174
MaeIII GTNAC 2 cut(s) 194, 334
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 10
MfeI CAATTG 1 cut(s) 208
MluCI AATT 3 cut(s) 151, 199, 208
MmeI TCCRAC 2 cut(s) 43, 112
MnlI CCTC 1 cut(s) 94
MunI CAATTG 1 cut(s) 208
NdeII GATC 1 cut(s) 3
NlaIII CATG 2 cut(s) 14, 40
NmuCI GTSAC 2 cut(s) 194, 334
NspI RCATGY 1 cut(s) 14
PflMI CCANNNNNTGG 1 cut(s) 230
PkrI GCNGC 1 cut(s) 321
Psp1406I AACGTT 1 cut(s) 174
PstI CTGCAG 1 cut(s) 321
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
SatI GCNGC 1 cut(s) 320
Sau3AI GATC 1 cut(s) 3
SetI ASST 4 cut(s) 159, 177, 187, 277
SfaNI GCATC 3 cut(s) 79, 227, 244
SfcI CTRYAG 1 cut(s) 317
SgeI CNNG 6 cut(s) 23, 45, 49, 91, 112, 288
Sse9I AATT 3 cut(s) 151, 199, 208
SspMI CTAG 1 cut(s) 346
TaaI ACNGT 1 cut(s) 340
TaiI ACGT 2 cut(s) 159, 177
TasI AATT 3 cut(s) 151, 199, 208
TscAI CASTG 1 cut(s) 343
TseFI GTSAC 2 cut(s) 194, 334
TseI GCWGC 1 cut(s) 319
Tsp45I GTSAC 2 cut(s) 194, 334
TspDTI ATGAA 2 cut(s) 285, 288
TspRI CASTG 1 cut(s) 343
Van91I CCANNNNNTGG 1 cut(s) 230
XceI RCATGY 1 cut(s) 14
XspI CTAG 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.