Rh1CG215900

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001155
Physical Location & Seq
Reverse (-)
46476150 .. 46479687
3538 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG215900.1

Sequence Viewer

Length: 261 bp
ATGGCAATCAGTACTCCTCTTGTTGTGATAGCCTTTTTTGTTGTTTTTCCAAGCATGGTTTTGGCAAAACAGTATGTTGTTGGAGATGATGAAGGCTGGGATGGTAATGTTGATTACCAAGCTTGGGCAGATGACAAAACTTTCAAACTTGGAGATGTTTTAATATTCAAATACGATGCTGGTAGCCATAACGTTGCTCAAGCGTTTAATGCTGATGGCTATGACAGTTCACTTAAGAAACCTAAGCACAACATAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

86

Amino Acids

9.49

Weight (kDa)

4.74

Isoelectric Point (pI)

25.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 33 - 76 1e-10 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 192
AfaI GTAC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 124
AflII CTTAAG 1 cut(s) 233
AgsI TTSAA 2 cut(s) 145, 169
AluBI AGCT 2 cut(s) 122, 258
AluI AGCT 2 cut(s) 122, 258
BccI CCATC 2 cut(s) 95, 209
BfrI CTTAAG 1 cut(s) 233
BmcAI AGTACT 1 cut(s) 13
BmsI GCATC 1 cut(s) 166
Bpu10I CCTNAGC 1 cut(s) 243
BpuEI CTTGAG 1 cut(s) 183
Bsc4I CCNNNNNNNGG 1 cut(s) 124
BseGI GGATG 1 cut(s) 106
BseLI CCNNNNNNNGG 1 cut(s) 124
BseRI GAGGAG 1 cut(s) 6
BseYI CCCAGC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 124
BspTI CTTAAG 1 cut(s) 233
Bst4CI ACNGT 2 cut(s) 72, 227
BstAFI CTTAAG 1 cut(s) 233
BstDEI CTNAG 1 cut(s) 243
BstF5I GGATG 1 cut(s) 106
BstMWI GCNNNNNNNGC 1 cut(s) 209
BtsCI GGATG 1 cut(s) 106
Csp6I GTAC 1 cut(s) 12
CviAII CATG 1 cut(s) 55
CviJI RGCY 6 cut(s) 32, 96, 122, 186, 219, 258
CviKI_1 RGCY 6 cut(s) 32, 96, 122, 186, 219, 258
CviQI GTAC 1 cut(s) 12
DdeI CTNAG 1 cut(s) 243
FaeI CATG 1 cut(s) 58
FaiI YATR 5 cut(s) 56, 75, 189, 222, 254
FatI CATG 1 cut(s) 54
FokI GGATG 1 cut(s) 113
GsaI CCCAGC 1 cut(s) 100
Hin1II CATG 1 cut(s) 58
HindIII AAGCTT 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 230
Hpy8I GTNNAC 1 cut(s) 230
HpyAV CCTTC 1 cut(s) 86
HpyCH4III ACNGT 2 cut(s) 72, 227
HpyCH4IV ACGT 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 209
HpyF3I CTNAG 1 cut(s) 243
HpySE526I ACGT 1 cut(s) 192
Hsp92II CATG 1 cut(s) 58
LpnPI CCDG 2 cut(s) 82, 165
LweI GCATC 1 cut(s) 166
MaeII ACGT 1 cut(s) 192
MmeI TCCRAC 1 cut(s) 61
MnlI CCTC 1 cut(s) 27
MseI TTAA 3 cut(s) 161, 207, 234
MspCI CTTAAG 1 cut(s) 233
MwoI GCNNNNNNNGC 1 cut(s) 209
NlaIII CATG 1 cut(s) 58
Psp1406I AACGTT 1 cut(s) 192
PspFI CCCAGC 1 cut(s) 96
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SaqAI TTAA 3 cut(s) 161, 207, 234
ScaI AGTACT 1 cut(s) 13
SetI ASST 4 cut(s) 124, 195, 244, 260
SfaNI GCATC 1 cut(s) 166
SgeI CNNG 9 cut(s) 32, 63, 67, 109, 131, 135, 161, 192, 212
SmlI CTYRAG 2 cut(s) 198, 233
SmoI CTYRAG 2 cut(s) 198, 233
SspI AATATT 1 cut(s) 165
TaaI ACNGT 2 cut(s) 72, 227
TaiI ACGT 1 cut(s) 195
TatI WGTACW 1 cut(s) 11
Tru1I TTAA 3 cut(s) 161, 207, 234
Tru9I TTAA 3 cut(s) 161, 207, 234
TspDTI ATGAA 1 cut(s) 105
Vha464I CTTAAG 1 cut(s) 233
ZrmI AGTACT 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.