Rmu_sc0003700.1_g000010

Basic blue protein-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003700.1
Physical Location & Seq
Forward (+)
41714 .. 42188
475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003700.1_g000010.1.cds

Sequence Viewer

Length: 351 bp
atggcacgagttagtactgctctggtgttgattgccttcttcgttgtttttccgagcatggttttggcgacacaatatgttgttggagatgatttaggttggaatggtgatgctgattacgagggttgggttgctgacaaaactttctttgttggagatgttttagctgaccacaacgttgttatagctactaatggtgacaattatgacaattgtgttgcatctccaaactttggtgtgtacgacagtgggaatgatgcaataacattgaatgaagctggaacttactacttcttatgttcatatcattgcgactatctgcaacagaaagttatggtcactgtgaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.73

Weight (kDa)

4.05

Isoelectric Point (pI)

21.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 233
AclI AACGTT 1 cut(s) 177
AfaI GTAC 2 cut(s) 16, 242
AfiI CCNNNNNNNGG 1 cut(s) 233
AgsI TTSAA 1 cut(s) 271
AluBI AGCT 3 cut(s) 167, 188, 278
AluI AGCT 3 cut(s) 167, 188, 278
AsuHPI GGTGA 2 cut(s) 119, 209
BauI CACGAG 1 cut(s) 6
BfaI CTAG 1 cut(s) 349
BmcAI AGTACT 1 cut(s) 16
BmsI GCATC 3 cut(s) 100, 230, 247
Bsc4I CCNNNNNNNGG 1 cut(s) 233
Bse3DI GCAATG 1 cut(s) 307
BseLI CCNNNNNNNGG 1 cut(s) 233
BseMI GCAATG 1 cut(s) 307
BslI CCNNNNNNNGG 1 cut(s) 233
BsrDI GCAATG 1 cut(s) 307
BssSI CACGAG 1 cut(s) 6
Bst2BI CACGAG 1 cut(s) 6
Bst4CI ACNGT 2 cut(s) 248, 343
BtsIMutI CAGTG 2 cut(s) 253, 339
Csp6I GTAC 2 cut(s) 15, 241
CviAII CATG 1 cut(s) 58
CviJI RGCY 3 cut(s) 167, 188, 278
CviKI_1 RGCY 3 cut(s) 167, 188, 278
CviQI GTAC 2 cut(s) 15, 241
FaeI CATG 1 cut(s) 61
FaiI YATR 7 cut(s) 59, 78, 185, 207, 298, 304, 335
FatI CATG 1 cut(s) 57
FspBI CTAG 1 cut(s) 349
Hin1II CATG 1 cut(s) 61
HphI GGTGA 2 cut(s) 119, 209
Hpy166II GTNNAC 2 cut(s) 241, 346
Hpy188I TCNGA 1 cut(s) 54
Hpy8I GTNNAC 2 cut(s) 241, 346
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 2 cut(s) 248, 343
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 3 cut(s) 221, 260, 322
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 1 cut(s) 61
LpnPI CCDG 2 cut(s) 8, 264
LweI GCATC 3 cut(s) 100, 230, 247
MaeI CTAG 1 cut(s) 349
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 2 cut(s) 197, 337
MboII GAAGA 1 cut(s) 31
MfeI CAATTG 1 cut(s) 211
MluCI AATT 2 cut(s) 202, 211
MmeI TCCRAC 3 cut(s) 64, 80, 133
MnlI CCTC 1 cut(s) 115
MunI CAATTG 1 cut(s) 211
NlaIII CATG 1 cut(s) 61
NmuCI GTSAC 2 cut(s) 197, 337
PflMI CCANNNNNTGG 1 cut(s) 233
Psp1406I AACGTT 1 cut(s) 177
RsaI GTAC 2 cut(s) 16, 242
RsaNI GTAC 2 cut(s) 15, 241
ScaI AGTACT 1 cut(s) 16
SetI ASST 5 cut(s) 100, 169, 180, 190, 280
SfaNI GCATC 3 cut(s) 100, 230, 247
SgeI CNNG 7 cut(s) 18, 20, 35, 66, 70, 133, 291
Sse9I AATT 2 cut(s) 202, 211
SspMI CTAG 1 cut(s) 349
TaaI ACNGT 2 cut(s) 248, 343
TaiI ACGT 1 cut(s) 180
TasI AATT 2 cut(s) 202, 211
TatI WGTACW 1 cut(s) 14
TscAI CASTG 2 cut(s) 253, 346
TseFI GTSAC 2 cut(s) 197, 337
Tsp45I GTSAC 2 cut(s) 197, 337
TspDTI ATGAA 2 cut(s) 288, 291
TspRI CASTG 2 cut(s) 253, 346
Van91I CCANNNNNTGG 1 cut(s) 233
XspI CTAG 1 cut(s) 349
ZrmI AGTACT 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.