Rmu_sc0009891.1_g000010

Basic blue protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009891.1
OG0001155
Physical Location & Seq
Forward (+)
34675 .. 35122
448 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009891.1_g000010.1.cds

Sequence Viewer

Length: 318 bp
atggcacgagtcactactgctcttgttgtcattgccttttccgtcgtttttccgagcatggttctggcaacagaatatgttgtcggagatgatctaggctgggacggaactgctaattaccaagcttgggctgatgaccatgctttccatgttggagatgtcttaaggattgatacttgtgtttcatctccaagcttattaggtgtgtacgacagtggcaatgacgcattaaccttgagccttgctggaacctactacttcttatgtggatatcactgcgatacacttcagcagaatttctttatcgttgtggactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu_bind_like

Protein Analysis

105

Amino Acids

11.42

Weight (kDa)

4.05

Isoelectric Point (pI)

24.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 295
AcuI CTGAAG 1 cut(s) 272
AfaI GTAC 1 cut(s) 209
AfiI CCNNNNNNNGG 1 cut(s) 127
AflII CTTAAG 1 cut(s) 163
AluBI AGCT 2 cut(s) 125, 195
AluI AGCT 2 cut(s) 125, 195
ApoI RAATTY 1 cut(s) 295
BaeI ACNNNNGTAYC 2 cut(s) 165, 198
BauI CACGAG 1 cut(s) 6
BfaI CTAG 2 cut(s) 95, 316
BfrI CTTAAG 1 cut(s) 163
BmiI GGNNCC 1 cut(s) 250
BpuEI CTTGAG 1 cut(s) 256
Bsc4I CCNNNNNNNGG 1 cut(s) 127
Bse3DI GCAATG 2 cut(s) 30, 226
BseLI CCNNNNNNNGG 1 cut(s) 127
BseMI GCAATG 2 cut(s) 30, 226
BseYI CCCAGC 1 cut(s) 99
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 250
BspTI CTTAAG 1 cut(s) 163
BsrDI GCAATG 2 cut(s) 30, 226
BssMI GATC 1 cut(s) 91
BssSI CACGAG 1 cut(s) 6
Bst2BI CACGAG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 215
BstAFI CTTAAG 1 cut(s) 163
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BtsI GCAGTG 1 cut(s) 274
BtsIMutI CAGTG 2 cut(s) 220, 274
CseI GACGC 1 cut(s) 233
Csp6I GTAC 1 cut(s) 208
CviAII CATG 3 cut(s) 58, 140, 149
CviJI RGCY 5 cut(s) 99, 125, 131, 195, 240
CviKI_1 RGCY 5 cut(s) 99, 125, 131, 195, 240
CviQI GTAC 1 cut(s) 208
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco32I GATATC 1 cut(s) 272
Eco57I CTGAAG 1 cut(s) 272
EcoRV GATATC 1 cut(s) 272
FaeI CATG 3 cut(s) 61, 143, 152
FaiI YATR 5 cut(s) 59, 78, 141, 150, 265
FaqI GGGAC 1 cut(s) 116
FatI CATG 3 cut(s) 57, 139, 148
FspBI CTAG 2 cut(s) 95, 316
GsaI CCCAGC 1 cut(s) 103
HgaI GACGC 1 cut(s) 233
Hin1II CATG 3 cut(s) 61, 143, 152
HindIII AAGCTT 2 cut(s) 123, 193
HinfI GANTC 1 cut(s) 9
Hpy166II GTNNAC 2 cut(s) 208, 313
Hpy188I TCNGA 2 cut(s) 54, 86
Hpy8I GTNNAC 2 cut(s) 208, 313
Hpy99I CGWCG 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 215
Hsp92II CATG 3 cut(s) 61, 143, 152
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 3 cut(s) 50, 85, 231
MaeI CTAG 2 cut(s) 95, 316
MaeIII GTNAC 1 cut(s) 10
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 2 cut(s) 115, 295
MlyI GAGTC 1 cut(s) 18
MmeI TCCRAC 2 cut(s) 64, 133
MseI TTAA 2 cut(s) 164, 230
MspCI CTTAAG 1 cut(s) 163
NdeII GATC 1 cut(s) 91
NlaIII CATG 3 cut(s) 61, 143, 152
NlaIV GGNNCC 1 cut(s) 250
NmuCI GTSAC 1 cut(s) 10
PleI GAGTC 1 cut(s) 17
PpsI GAGTC 1 cut(s) 17
PspFI CCCAGC 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 250
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
SaqAI TTAA 2 cut(s) 164, 230
Sau3AI GATC 1 cut(s) 91
SchI GAGTC 1 cut(s) 18
SetI ASST 5 cut(s) 127, 197, 205, 236, 254
SmlI CTYRAG 2 cut(s) 163, 235
SmoI CTYRAG 2 cut(s) 163, 235
Sse9I AATT 2 cut(s) 115, 295
SspMI CTAG 2 cut(s) 95, 316
TaaI ACNGT 1 cut(s) 215
TasI AATT 2 cut(s) 115, 295
Tru1I TTAA 2 cut(s) 164, 230
Tru9I TTAA 2 cut(s) 164, 230
TscAI CASTG 2 cut(s) 220, 281
TseFI GTSAC 1 cut(s) 10
Tsp45I GTSAC 1 cut(s) 10
TspDTI ATGAA 1 cut(s) 174
TspGWI ACGGA 2 cut(s) 31, 120
TspRI CASTG 2 cut(s) 220, 281
Vha464I CTTAAG 1 cut(s) 163
XapI RAATTY 1 cut(s) 295
XspI CTAG 2 cut(s) 95, 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.