RchiOBHm_Chr5g0043741

Belongs to the lyase 1 family. Adenylosuccinate lyase subfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
38784698 .. 38785110
413 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32197

Sequence Viewer

Length: 240 bp
ATGGTCAGTCATATTTACAAGAACGTACTGATTGGTGGATTTAGCATAAGTGATGCAGTAGAAATAAAGAAGATTGAGAGAGAGACCAACCATGATGTTAAAGTGGTGCTTGAATTTTTCCATTTTGCTTGCACATCTGAGGATATCAACAATCTTGCCCGTGCATTAATGCTAGAAGGAGCCATGAACAATGTCGTAATCCCTTTCATGGATGATTTGATTCAAGCACGTACTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.96

Weight (kDa)

5.15

Isoelectric Point (pI)

33.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 2 cut(s) 27, 232
AfiI CCNNNNNNNGG 1 cut(s) 208
AgsI TTSAA 2 cut(s) 113, 224
Alw26I GTCTC 1 cut(s) 77
ApoI RAATTY 1 cut(s) 113
AseI ATTAAT 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 77
BfaI CTAG 1 cut(s) 173
BmiI GGNNCC 1 cut(s) 181
BmsI GCATC 1 cut(s) 43
BsaAI YACGTR 1 cut(s) 230
BsaI GGTCTC 1 cut(s) 77
Bsc4I CCNNNNNNNGG 1 cut(s) 208
BseGI GGATG 1 cut(s) 217
BseLI CCNNNNNNNGG 1 cut(s) 208
BseMII CTCAG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 208
BsmAI GTCTC 1 cut(s) 77
Bso31I GGTCTC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 181
BspTNI GGTCTC 1 cut(s) 77
BstBAI YACGTR 1 cut(s) 230
BstC8I GCNNGC 1 cut(s) 130
BstDEI CTNAG 1 cut(s) 138
BstF5I GGATG 1 cut(s) 217
BstMAI GTCTC 1 cut(s) 77
BtsCI GGATG 1 cut(s) 217
Cac8I GCNNGC 1 cut(s) 130
Csp6I GTAC 2 cut(s) 26, 231
CviAII CATG 3 cut(s) 92, 184, 208
CviJI RGCY 1 cut(s) 182
CviKI_1 RGCY 1 cut(s) 182
CviQI GTAC 2 cut(s) 26, 231
DdeI CTNAG 1 cut(s) 138
Eco31I GGTCTC 1 cut(s) 77
Eco32I GATATC 1 cut(s) 145
EcoRV GATATC 1 cut(s) 145
FaeI CATG 3 cut(s) 95, 187, 211
FaiI YATR 6 cut(s) 12, 47, 93, 185, 209, 236
FalI AAGNNNNNCTT 2 cut(s) 93, 125
FatI CATG 3 cut(s) 91, 183, 207
FokI GGATG 1 cut(s) 224
FspBI CTAG 1 cut(s) 173
Hin1II CATG 3 cut(s) 95, 187, 211
HinfI GANTC 1 cut(s) 220
Hpy188I TCNGA 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 170
HpyCH4IV ACGT 2 cut(s) 24, 229
HpyCH4V TGCA 3 cut(s) 56, 132, 164
HpyF3I CTNAG 1 cut(s) 138
HpySE526I ACGT 2 cut(s) 24, 229
Hsp92II CATG 3 cut(s) 95, 187, 211
LmnI GCTCC 1 cut(s) 179
LweI GCATC 1 cut(s) 43
MaeI CTAG 1 cut(s) 173
MaeII ACGT 2 cut(s) 24, 229
MboII GAAGA 1 cut(s) 82
MluCI AATT 1 cut(s) 113
MnlI CCTC 1 cut(s) 133
MseI TTAA 2 cut(s) 99, 167
NlaIII CATG 3 cut(s) 95, 187, 211
NlaIV GGNNCC 1 cut(s) 181
PfeI GAWTC 1 cut(s) 220
Ppu21I YACGTR 1 cut(s) 230
PshBI ATTAAT 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 181
RsaI GTAC 2 cut(s) 27, 232
RsaNI GTAC 2 cut(s) 26, 231
SaqAI TTAA 2 cut(s) 99, 167
SetI ASST 2 cut(s) 27, 232
SfaNI GCATC 1 cut(s) 43
Sse9I AATT 1 cut(s) 113
SspMI CTAG 1 cut(s) 173
TaiI ACGT 2 cut(s) 27, 232
TasI AATT 1 cut(s) 113
TfiI GAWTC 1 cut(s) 220
Tru1I TTAA 2 cut(s) 99, 167
Tru9I TTAA 2 cut(s) 99, 167
TspDTI ATGAA 2 cut(s) 196, 200
VspI ATTAAT 1 cut(s) 167
XapI RAATTY 1 cut(s) 113
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.