Rh5BG299700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0000912
Physical Location & Seq
Forward (+)
38662412 .. 38678750
16339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG299700.1

Sequence Viewer

Length: 156 bp
ATGGCTAAGGCCAATGCTCATATTCCTAGGGGGTCTCGTACTCGTGGCCAGGTGTATGAAGAACTCATCAATGTAGAGTTGGACCTGTCTCACCCATCTTTTTCTGGACCACTAAAGGCTCTTTTACTGTTGCTTAGTCTATCCTCTACGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.56

Weight (kDa)

9.52

Isoelectric Point (pI)

24.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 46
AfaI GTAC 1 cut(s) 40
AjnI CCWGG 1 cut(s) 48
Alw26I GTCTC 2 cut(s) 39, 93
AoxI GGCC 2 cut(s) 9, 46
AspA2I CCTAGG 1 cut(s) 26
AspS9I GGNCC 2 cut(s) 82, 107
AsuHPI GGTGA 1 cut(s) 83
AvaII GGWCC 2 cut(s) 82, 107
AvrII CCTAGG 1 cut(s) 26
BalI TGGCCA 1 cut(s) 48
BauI CACGAG 1 cut(s) 42
BccI CCATC 1 cut(s) 103
BciT130I CCWGG 1 cut(s) 50
BcoDI GTCTC 2 cut(s) 39, 93
BfaI CTAG 1 cut(s) 27
BlnI CCTAGG 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 50
Bme18I GGWCC 2 cut(s) 82, 107
BmgT120I GGNCC 2 cut(s) 82, 107
BmrFI CCNGG 1 cut(s) 50
Bpu10I CCTNAGC 1 cut(s) 6
BsaI GGTCTC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 26
BshFI GGCC 2 cut(s) 11, 48
BsmAI GTCTC 2 cut(s) 39, 93
BsnI GGCC 2 cut(s) 11, 48
Bso31I GGTCTC 1 cut(s) 39
BspANI GGCC 2 cut(s) 11, 48
BspTNI GGTCTC 1 cut(s) 39
BssECI CCNNGG 1 cut(s) 26
BssSI CACGAG 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 26
Bst2BI CACGAG 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 50
Bst4CI ACNGT 1 cut(s) 129
BstDEI CTNAG 2 cut(s) 6, 134
BstMAI GTCTC 2 cut(s) 39, 93
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 1 cut(s) 48
BsuRI GGCC 2 cut(s) 11, 48
Cfr13I GGNCC 2 cut(s) 82, 107
Csp6I GTAC 1 cut(s) 39
CviJI RGCY 4 cut(s) 5, 11, 48, 119
CviKI_1 RGCY 4 cut(s) 5, 11, 48, 119
CviQI GTAC 1 cut(s) 39
DdeI CTNAG 2 cut(s) 6, 134
EaeI YGGCCR 1 cut(s) 46
Eco130I CCWWGG 1 cut(s) 26
Eco31I GGTCTC 1 cut(s) 39
Eco47I GGWCC 2 cut(s) 82, 107
EcoRII CCWGG 1 cut(s) 48
EcoT14I CCWWGG 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 26
FaiI YATR 2 cut(s) 21, 57
FspBI CTAG 1 cut(s) 27
HaeIII GGCC 2 cut(s) 11, 48
HphI GGTGA 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 105
HpyCH4III ACNGT 1 cut(s) 129
HpyF3I CTNAG 2 cut(s) 6, 134
LpnPI CCDG 4 cut(s) 35, 62, 90, 98
MaeI CTAG 1 cut(s) 27
MboII GAAGA 1 cut(s) 71
MlsI TGGCCA 1 cut(s) 48
MluNI TGGCCA 1 cut(s) 48
MmeI TCCRAC 1 cut(s) 60
MnlI CCTC 1 cut(s) 154
Mox20I TGGCCA 1 cut(s) 48
MscI TGGCCA 1 cut(s) 48
Msp20I TGGCCA 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 50
MvaI CCWGG 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
PspPI GGNCC 2 cut(s) 82, 107
RsaI GTAC 1 cut(s) 40
RsaNI GTAC 1 cut(s) 39
Sau96I GGNCC 2 cut(s) 82, 107
ScrFI CCNGG 1 cut(s) 50
SetI ASST 2 cut(s) 54, 87
SgeI CNNG 8 cut(s) 39, 48, 54, 56, 61, 62, 97, 117
SinI GGWCC 2 cut(s) 82, 107
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 48
StyI CCWWGG 1 cut(s) 26
TaaI ACNGT 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 72
VpaK11BI GGWCC 2 cut(s) 82, 107
XmaJI CCTAGG 1 cut(s) 26
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.