RchiOBHm_Chr5g0043751

Belongs to the lyase 1 family. Adenylosuccinate lyase subfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000912
Physical Location & Seq
Forward (+)
38785125 .. 38786530
1406 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32198

Sequence Viewer

Length: 180 bp
ATGCTCATATTCCTAGGGGGTCTCGTACTCGTGGCCAGATTAAGGAGAGAAAGGAAAGAGATCTCTTCAGTGGCGATAATGGGGAAATTTTCTGGTGCTGTTGGAAATTACAACACTCATCTTGTTGCATATCCTAATATTAATTGGCCCCATATTAGGCATAATTATGGAAGGGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00250 ko01100 ko01110 ko01130 map00230 map00250 map01100 map01110 map01130
Pfam Domains
Protein Families
ASL_C Lyase_1

Protein Analysis

59

Amino Acids

6.72

Weight (kDa)

10.51

Isoelectric Point (pI)

45.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 33
AcsI RAATTY 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 51
AfaI GTAC 1 cut(s) 27
AfiI CCNNNNNNNGG 2 cut(s) 42, 156
Alw26I GTCTC 1 cut(s) 26
AoxI GGCC 2 cut(s) 33, 146
ApoI RAATTY 1 cut(s) 86
AseI ATTAAT 1 cut(s) 141
AspA2I CCTAGG 1 cut(s) 13
AspS9I GGNCC 1 cut(s) 147
AvrII CCTAGG 1 cut(s) 13
BalI TGGCCA 1 cut(s) 35
BauI CACGAG 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 26
BfaI CTAG 1 cut(s) 14
BglII AGATCT 1 cut(s) 60
BlnI CCTAGG 1 cut(s) 13
BmgT120I GGNCC 1 cut(s) 147
BmiI GGNNCC 1 cut(s) 149
BsaI GGTCTC 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 13
Bsc4I CCNNNNNNNGG 2 cut(s) 42, 156
BseDI CCNNGG 1 cut(s) 13
BseLI CCNNNNNNNGG 2 cut(s) 42, 156
BshFI GGCC 2 cut(s) 35, 148
BslI CCNNNNNNNGG 2 cut(s) 42, 156
BsmAI GTCTC 1 cut(s) 26
BsnI GGCC 2 cut(s) 35, 148
Bso31I GGTCTC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 60
BspANI GGCC 2 cut(s) 35, 148
BspLI GGNNCC 1 cut(s) 149
BspTNI GGTCTC 1 cut(s) 26
BssECI CCNNGG 1 cut(s) 13
BssMI GATC 1 cut(s) 60
BssSI CACGAG 1 cut(s) 29
BssT1I CCWWGG 1 cut(s) 13
Bst2BI CACGAG 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 70
BstKTI GATC 1 cut(s) 63
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 1 cut(s) 60
BstX2I RGATCY 1 cut(s) 60
BstYI RGATCY 1 cut(s) 60
BsuRI GGCC 2 cut(s) 35, 148
BtsIMutI CAGTG 1 cut(s) 75
Cfr13I GGNCC 1 cut(s) 147
Csp6I GTAC 1 cut(s) 26
CviJI RGCY 2 cut(s) 35, 148
CviKI_1 RGCY 2 cut(s) 35, 148
CviQI GTAC 1 cut(s) 26
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
EaeI YGGCCR 1 cut(s) 33
Eam1104I CTCTTC 1 cut(s) 70
EarI CTCTTC 1 cut(s) 70
Eco130I CCWWGG 1 cut(s) 13
Eco31I GGTCTC 1 cut(s) 26
Eco57I CTGAAG 1 cut(s) 51
EcoT14I CCWWGG 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 13
FaiI YATR 5 cut(s) 8, 130, 153, 162, 168
FspBI CTAG 1 cut(s) 14
HaeIII GGCC 2 cut(s) 35, 148
HpyAV CCTTC 1 cut(s) 165
HpyCH4V TGCA 1 cut(s) 128
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 2 cut(s) 49, 78
MaeI CTAG 1 cut(s) 14
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 1 cut(s) 57
MflI RGATCY 1 cut(s) 60
MlsI TGGCCA 1 cut(s) 35
MluCI AATT 4 cut(s) 86, 106, 142, 163
MluNI TGGCCA 1 cut(s) 35
MmeI TCCRAC 1 cut(s) 82
Mox20I TGGCCA 1 cut(s) 35
MscI TGGCCA 1 cut(s) 35
MseI TTAA 2 cut(s) 41, 141
MslI CAYNNNNRTG 1 cut(s) 165
Msp20I TGGCCA 1 cut(s) 35
NdeII GATC 1 cut(s) 60
NlaIV GGNNCC 1 cut(s) 149
PshBI ATTAAT 1 cut(s) 141
PspN4I GGNNCC 1 cut(s) 149
PspPI GGNCC 1 cut(s) 147
PsuI RGATCY 1 cut(s) 60
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
RseI CAYNNNNRTG 1 cut(s) 165
SaqAI TTAA 2 cut(s) 41, 141
Sau3AI GATC 1 cut(s) 60
Sau96I GGNCC 1 cut(s) 147
SgeI CNNG 7 cut(s) 26, 35, 41, 43, 48, 105, 134
SmiMI CAYNNNNRTG 1 cut(s) 165
Sse9I AATT 4 cut(s) 86, 106, 142, 163
SspI AATATT 1 cut(s) 139
SspMI CTAG 1 cut(s) 14
StyI CCWWGG 1 cut(s) 13
TasI AATT 4 cut(s) 86, 106, 142, 163
Tru1I TTAA 2 cut(s) 41, 141
Tru9I TTAA 2 cut(s) 41, 141
TscAI CASTG 1 cut(s) 75
TspRI CASTG 1 cut(s) 75
VspI ATTAAT 1 cut(s) 141
XapI RAATTY 1 cut(s) 86
XmaJI CCTAGG 1 cut(s) 13
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.