Rh5DG308900

Belongs to the lyase 1 family. Adenylosuccinate lyase subfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
39463625 .. 39464078
454 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG308900.1

Sequence Viewer

Length: 294 bp
ATGCTAGAAGGAGCCATGAACAATGTCGTACTCCCTTTCATGGATGATTTGATTCAGGCTCTATGTAACATGGCCAAGGACAATGCTCATATTCCTAGGGGGTCTCGTACAATGCTCATATTTAGGCTTCTTGCATGTACTGAAATTCCTTTATCCTTGCTTGATGCACCAACTGTGGGGAAAGAAATGGCAACTTTTGCTGTGAGATTAGGAGGGAAAGTTTCTGGTGCTTTTGGAAATTACAACACTCATCTTGTTGCATATCCTAATATTAATTGGCCCCAAGTTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.56

Weight (kDa)

6.7

Isoelectric Point (pI)

35.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 72
AcsI RAATTY 1 cut(s) 144
AfaI GTAC 3 cut(s) 30, 109, 139
AfiI CCNNNNNNNGG 2 cut(s) 40, 176
Alw26I GTCTC 1 cut(s) 108
AoxI GGCC 2 cut(s) 72, 278
ApoI RAATTY 1 cut(s) 144
AseI ATTAAT 1 cut(s) 273
AspA2I CCTAGG 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 279
AvrII CCTAGG 1 cut(s) 95
BalI TGGCCA 1 cut(s) 74
BcoDI GTCTC 1 cut(s) 108
BfaI CTAG 2 cut(s) 5, 96
BlnI CCTAGG 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 279
BmiI GGNNCC 2 cut(s) 13, 281
BmsI GCATC 1 cut(s) 154
BsaI GGTCTC 1 cut(s) 108
BsaJI CCNNGG 2 cut(s) 75, 95
BsaXI ACNNNNNCTCC 2 cut(s) 204, 234
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 176
BseDI CCNNGG 2 cut(s) 75, 95
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 2 cut(s) 40, 176
BshFI GGCC 2 cut(s) 74, 280
BslI CCNNNNNNNGG 2 cut(s) 40, 176
BsmAI GTCTC 1 cut(s) 108
BsnI GGCC 2 cut(s) 74, 280
Bso31I GGTCTC 1 cut(s) 108
BspANI GGCC 2 cut(s) 74, 280
BspLI GGNNCC 2 cut(s) 13, 281
BspTNI GGTCTC 1 cut(s) 108
BssECI CCNNGG 2 cut(s) 75, 95
BssT1I CCWWGG 2 cut(s) 75, 95
Bst4CI ACNGT 1 cut(s) 175
BstAPI GCANNNNNTGC 1 cut(s) 197
BstF5I GGATG 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstNSI RCATGY 1 cut(s) 138
BsuRI GGCC 2 cut(s) 74, 280
BtsCI GGATG 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 279
Csp6I GTAC 3 cut(s) 29, 108, 138
CviAII CATG 4 cut(s) 16, 40, 70, 135
CviJI RGCY 5 cut(s) 14, 59, 74, 127, 280
CviKI_1 RGCY 5 cut(s) 14, 59, 74, 127, 280
CviQI GTAC 3 cut(s) 29, 108, 138
EaeI YGGCCR 1 cut(s) 72
Eco130I CCWWGG 2 cut(s) 75, 95
Eco31I GGTCTC 1 cut(s) 108
EcoT14I CCWWGG 2 cut(s) 75, 95
ErhI CCWWGG 2 cut(s) 75, 95
FaeI CATG 4 cut(s) 19, 43, 73, 138
FaiI YATR 8 cut(s) 17, 41, 64, 71, 90, 119, 136, 262
FatI CATG 4 cut(s) 15, 39, 69, 134
FokI GGATG 1 cut(s) 56
FspBI CTAG 2 cut(s) 5, 96
HaeIII GGCC 2 cut(s) 74, 280
Hin1II CATG 4 cut(s) 19, 43, 73, 138
HinfI GANTC 1 cut(s) 52
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 3 cut(s) 134, 167, 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
Hsp92II CATG 4 cut(s) 19, 43, 73, 138
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 2 cut(s) 41, 210
LweI GCATC 1 cut(s) 154
MaeI CTAG 2 cut(s) 5, 96
MaeIII GTNAC 1 cut(s) 65
MlsI TGGCCA 1 cut(s) 74
MluCI AATT 3 cut(s) 144, 238, 274
MluNI TGGCCA 1 cut(s) 74
MnlI CCTC 1 cut(s) 206
Mox20I TGGCCA 1 cut(s) 74
MscI TGGCCA 1 cut(s) 74
MseI TTAA 2 cut(s) 273, 292
Msp20I TGGCCA 1 cut(s) 74
MwoI GCNNNNNNNGC 1 cut(s) 197
NlaIII CATG 4 cut(s) 19, 43, 73, 138
NlaIV GGNNCC 2 cut(s) 13, 281
NspI RCATGY 1 cut(s) 138
PfeI GAWTC 1 cut(s) 52
PshBI ATTAAT 1 cut(s) 273
PspN4I GGNNCC 2 cut(s) 13, 281
PspPI GGNCC 1 cut(s) 279
RsaI GTAC 3 cut(s) 30, 109, 139
RsaNI GTAC 3 cut(s) 29, 108, 138
SaqAI TTAA 2 cut(s) 273, 292
Sau96I GGNCC 1 cut(s) 279
SfaNI GCATC 1 cut(s) 154
Sse9I AATT 3 cut(s) 144, 238, 274
SspI AATATT 1 cut(s) 271
SspMI CTAG 2 cut(s) 5, 96
StyI CCWWGG 2 cut(s) 75, 95
TaaI ACNGT 1 cut(s) 175
TasI AATT 3 cut(s) 144, 238, 274
TatI WGTACW 1 cut(s) 137
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 2 cut(s) 273, 292
Tru9I TTAA 2 cut(s) 273, 292
TspDTI ATGAA 2 cut(s) 28, 32
VspI ATTAAT 1 cut(s) 273
XapI RAATTY 1 cut(s) 144
XceI RCATGY 1 cut(s) 138
XmaJI CCTAGG 1 cut(s) 95
XspI CTAG 2 cut(s) 5, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.