Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0001329

Physical Location & Seq

Genomic Coordinates Forward (+)

16431871 .. 16436255

Gene Structure 4385 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ17763

Sequence Viewer

CDS Protein Promoter (2k)

Length: 126 bp

ATGGTTTTGGGATTGGTTGTAGCTAATGTTGCTATTTTTCCTTTATGGAGGATAGCAGACCCTATATTCATGTACAAGAATTTTACTCTGCTTGATTATGTGTACCCATTGGCTTTTCATAAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rhomboid

Protein Analysis

41

Amino Acids

4.8

Weight (kDa)

8.16

Isoelectric Point (pI)

27.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001329)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G18600
fragaria_vesca	FvH4_5g13610 FvH4_5g13610 FvH4_5g13610 FvH4_5g13620 FvH4_5g13640 FvH4_5g13640 FvH4_5g13640 FvH4_5g13640
malus_domestica	MD14G1214000.v1.1
prunus_persica	Prupe.3G124800_v2.0.a1 Prupe.3G124800_v2.0.a1 Prupe.3G124800_v2.0.a1 Prupe.5G207200_v2.0.a1 Prupe.5G207200_v2.0.a1 Prupe.5G207200_v2.0.a1 Prupe.5G207300_v2.0.a1
pyrus_communis	pycom14g17740 pycom16g17930
rosa_chinensis	RchiOBHm_Chr1g0346931 RchiOBHm_Chr1g0346941 RchiOBHm_Chr6g0258631 RchiOBHm_Chr6g0258651 RchiOBHm_Chr7g0183321 RchiOBHm_Chr7g0183341 RchiOBHm_Chr7g0198541
rosa_laevigata	RLG00000005055 RLG00000005057 RLG00000024525
rosa_multiflora	Rmu_co8273229.1_g000001 Rmu_sc0008602.1_g000004
rosa_roxburghii	Rroxscaffold_2G00110010 Rroxscaffold_3G00270550 Rroxscaffold_3G00270560
rosa_rugosa	Rorug03G0286600.1 Rorug04G0408600 Rorug06G0456400 Rorug06G0456500 Rorug06G0456600 Rorug06G0456600 Rorug06G0456800 Rorug07G0030500
rosa_samantha	Rh7AG058100 Rh7AG058300 Rh7BG057900 Rh7BG058200 Rh7CG059500 Rh7CG059700 Rh7CG059800 Rh7CG059900 Rh7DG057800 Rh7DG058000
rosa_wichuraiana	Rw7G004770 Rw7G004790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	79
AfaI	GTAC	2 cut(s)	74, 104
AluBI	AGCT	1 cut(s)	23
AluI	AGCT	1 cut(s)	23
ApoI	RAATTY	1 cut(s)	79
Bsp1407I	TGTACA	1 cut(s)	72
BsrGI	TGTACA	1 cut(s)	72
BstAUI	TGTACA	1 cut(s)	72
BstMWI	GCNNNNNNNGC	1 cut(s)	29
Csp6I	GTAC	2 cut(s)	73, 103
CviAII	CATG	1 cut(s)	70
CviJI	RGCY	2 cut(s)	23, 113
CviKI_1	RGCY	2 cut(s)	23, 113
CviQI	GTAC	2 cut(s)	73, 103
FaeI	CATG	1 cut(s)	73
FaiI	YATR	5 cut(s)	46, 65, 71, 99, 120
FatI	CATG	1 cut(s)	69
FspEI	CC	8 cut(s)	31, 34, 54, 74, 75, 95, 119, 120
Hin1II	CATG	1 cut(s)	73
Hpy166II	GTNNAC	1 cut(s)	103
Hpy8I	GTNNAC	1 cut(s)	103
HpyF10VI	GCNNNNNNNGC	1 cut(s)	29
Hsp92II	CATG	1 cut(s)	73
MluCI	AATT	1 cut(s)	79
MnlI	CCTC	1 cut(s)	42
MwoI	GCNNNNNNNGC	1 cut(s)	29
NlaIII	CATG	1 cut(s)	73
RsaI	GTAC	2 cut(s)	74, 104
RsaNI	GTAC	2 cut(s)	73, 103
SetI	ASST	1 cut(s)	25
SgeI	CNNG	3 cut(s)	82, 88, 104
Sse9I	AATT	1 cut(s)	79
TasI	AATT	1 cut(s)	79
TatI	WGTACW	1 cut(s)	72
TspDTI	ATGAA	2 cut(s)	58, 107
XapI	RAATTY	1 cut(s)	79

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.