Rmu_sc0008602.1_g000004

Rhomboid family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008602.1
OG0001329
Physical Location & Seq
Forward (+)
30333 .. 33089
2757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008602.1_g000004.1.cds

Sequence Viewer

Length: 681 bp
atgagttgttcagttgcaagacttactgcatatgactataggagaacatggttgcgaaggttatcaagcggtgacatggttttgggattggttgtagctaatgttgctgtttttcttttatggaggatagcagaccctatattcatgtacaagaattttactatctcattaaacaattttacaagtggacgtcttcacacattgataacttctgcatttagtcacgttgatatttggcatatcatttctaacatgattggactgtatttttttgggatcaatattggaagaacttttgggcctgagtttttgctgaagttgtatctagctggagctattggtggctcagtcttttacttggtgcaccatgccttcctggctgcatcatcgaagaatcgaccatttgggattatggacgcttccaaggccccaggattgggggcaagcggtgctgttaatgctatcatgttgcttgatatattccttcaccccacagctaccctctactttgattttataataccagttcctgccatgctgctgggaatctttctaattggaaaggatatcttaagaataatggagggaaacagtcagatctcaggatctgcacacttgggcggtgcggcagtagcagccatagcctgggcaagacttcgaaaggggcgtggtttattctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rhomboid

Protein Analysis

226

Amino Acids

24.72

Weight (kDa)

10.06

Isoelectric Point (pI)

31.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 518
AatII GACGTC 1 cut(s) 193
AccB7I CCANNNNNTGG 1 cut(s) 645
AciI CCGC 4 cut(s) 69, 447, 621, 626
AclWI GGATC 2 cut(s) 284, 613
AcsI RAATTY 1 cut(s) 154
AcuI CTGAAG 1 cut(s) 335
AcyI GRCGYC 1 cut(s) 190
AfaI GTAC 1 cut(s) 149
AfiI CCNNNNNNNGG 3 cut(s) 436, 437, 645
AflII CTTAAG 1 cut(s) 571
AjnI CCWGG 3 cut(s) 375, 430, 644
AluBI AGCT 4 cut(s) 98, 329, 335, 497
AluI AGCT 4 cut(s) 98, 329, 335, 497
Alw21I GWGCWC 1 cut(s) 366
Alw44I GTGCAC 1 cut(s) 362
AlwI GGATC 2 cut(s) 284, 613
AlwNI CAGNNNCTG 2 cut(s) 530, 608
AoxI GGCC 2 cut(s) 299, 426
ApaLI GTGCAC 1 cut(s) 362
ApeKI GCWGC 3 cut(s) 380, 538, 635
ApoI RAATTY 1 cut(s) 154
AspS9I GGNCC 2 cut(s) 299, 427
AsuHPI GGTGA 2 cut(s) 83, 479
AsuII TTCGAA 1 cut(s) 658
BaeGI GKGCMC 1 cut(s) 366
BbsI GAAGAC 1 cut(s) 185
Bbv12I GWGCWC 1 cut(s) 366
BbvI GCAGC 3 cut(s) 367, 525, 647
BciT130I CCWGG 3 cut(s) 377, 432, 646
BfaI CTAG 2 cut(s) 326, 679
BfmI CTRYAG 1 cut(s) 37
BfrI CTTAAG 1 cut(s) 571
BglI GCCNNNNNGGC 1 cut(s) 377
BglII AGATCT 1 cut(s) 597
BisI GCNGC 4 cut(s) 381, 539, 627, 636
BlsI GCNGC 4 cut(s) 382, 540, 628, 637
Bme1390I CCNGG 3 cut(s) 377, 432, 646
BmgT120I GGNCC 2 cut(s) 299, 427
BmiI GGNNCC 1 cut(s) 429
BmrFI CCNGG 3 cut(s) 377, 432, 646
BmsI GCATC 1 cut(s) 392
BpiI GAAGAC 1 cut(s) 185
BpmI CTGGAG 1 cut(s) 351
Bpu14I TTCGAA 1 cut(s) 658
BsaHI GRCGYC 1 cut(s) 190
BsaJI CCNNGG 3 cut(s) 423, 430, 645
Bsc4I CCNNNNNNNGG 3 cut(s) 436, 437, 645
Bse1I ACTGG 1 cut(s) 524
BseBI CCWGG 3 cut(s) 377, 432, 646
BseDI CCNNGG 3 cut(s) 423, 430, 645
BseLI CCNNNNNNNGG 3 cut(s) 436, 437, 645
BseMII CTCAG 3 cut(s) 294, 360, 615
BseNI ACTGG 1 cut(s) 524
BseSI GKGCMC 1 cut(s) 366
BseXI GCAGC 3 cut(s) 367, 525, 647
BseYI CCCAGC 1 cut(s) 541
BsgI GTGCAG 1 cut(s) 594
BshFI GGCC 2 cut(s) 301, 428
BsiHKAI GWGCWC 1 cut(s) 366
BslI CCNNNNNNNGG 3 cut(s) 436, 437, 645
BsnI GGCC 2 cut(s) 301, 428
Bsp119I TTCGAA 1 cut(s) 658
Bsp1286I GDGCHC 1 cut(s) 366
Bsp1407I TGTACA 1 cut(s) 147
Bsp143I GATC 3 cut(s) 276, 597, 605
BspACI CCGC 4 cut(s) 69, 447, 621, 626
BspANI GGCC 2 cut(s) 301, 428
BspCNI CTCAG 3 cut(s) 295, 359, 614
BspLI GGNNCC 1 cut(s) 429
BspPI GGATC 2 cut(s) 284, 613
BspT104I TTCGAA 1 cut(s) 658
BspTI CTTAAG 1 cut(s) 571
BsrGI TGTACA 1 cut(s) 147
BsrI ACTGG 1 cut(s) 524
BssECI CCNNGG 3 cut(s) 423, 430, 645
BssMI GATC 3 cut(s) 276, 597, 605
BssNI GRCGYC 1 cut(s) 190
BssT1I CCWWGG 1 cut(s) 423
Bst2UI CCWGG 3 cut(s) 377, 432, 646
Bst4CI ACNGT 2 cut(s) 264, 593
BstACI GRCGYC 1 cut(s) 190
BstAFI CTTAAG 1 cut(s) 571
BstAPI GCANNNNNTGC 1 cut(s) 449
BstAUI TGTACA 1 cut(s) 147
BstBI TTCGAA 1 cut(s) 658
BstC8I GCNNGC 1 cut(s) 445
BstDEI CTNAG 3 cut(s) 303, 346, 601
BstKTI GATC 3 cut(s) 279, 600, 608
BstMBI GATC 3 cut(s) 276, 597, 605
BstMWI GCNNNNNNNGC 8 cut(s) 104, 377, 425, 449, 458, 632, 635, 641
BstNI CCWGG 3 cut(s) 377, 432, 646
BstSCI CCNGG 3 cut(s) 375, 430, 644
BstSFI CTRYAG 1 cut(s) 37
BstSLI GKGCMC 1 cut(s) 366
BstV1I GCAGC 3 cut(s) 367, 525, 647
BstV2I GAAGAC 1 cut(s) 185
BstX2I RGATCY 2 cut(s) 597, 605
BstXI CCANNNNNNTGG 1 cut(s) 541
BstYI RGATCY 2 cut(s) 597, 605
BsuRI GGCC 2 cut(s) 301, 428
Cac8I GCNNGC 1 cut(s) 445
CaiI CAGNNNCTG 2 cut(s) 530, 608
Cfr13I GGNCC 2 cut(s) 299, 427
CseI GACGC 1 cut(s) 425
Csp6I GTAC 1 cut(s) 148
CviAII CATG 7 cut(s) 48, 76, 145, 253, 368, 466, 535
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 3 cut(s) 303, 346, 601
DpnI GATC 3 cut(s) 278, 599, 607
DpnII GATC 3 cut(s) 276, 597, 605
Eco130I CCWWGG 1 cut(s) 423
Eco32I GATATC 1 cut(s) 568
Eco57I CTGAAG 1 cut(s) 335
EcoO109I RGGNCCY 1 cut(s) 427
EcoRII CCWGG 3 cut(s) 375, 430, 644
EcoRV GATATC 1 cut(s) 568
EcoT14I CCWWGG 1 cut(s) 423
ErhI CCWWGG 1 cut(s) 423
FaeI CATG 7 cut(s) 51, 79, 148, 256, 371, 469, 538
FalI AAGNNNNNCTT 2 cut(s) 554, 586
FatI CATG 7 cut(s) 47, 75, 144, 252, 367, 465, 534
FauNDI CATATG 1 cut(s) 31
Fnu4HI GCNGC 4 cut(s) 381, 539, 627, 636
Fsp4HI GCNGC 4 cut(s) 381, 539, 627, 636
FspBI CTAG 2 cut(s) 326, 679
GluI GCNGC 4 cut(s) 381, 539, 627, 636
GsaI CCCAGC 1 cut(s) 545
GsuI CTGGAG 1 cut(s) 351
HaeIII GGCC 2 cut(s) 301, 428
HgaI GACGC 1 cut(s) 425
Hin1I GRCGYC 1 cut(s) 190
Hin1II CATG 7 cut(s) 51, 79, 148, 256, 371, 469, 538
HinfI GANTC 2 cut(s) 394, 546
HphI GGTGA 2 cut(s) 83, 479
Hpy166II GTNNAC 2 cut(s) 188, 364
Hpy188I TCNGA 1 cut(s) 597
Hpy188III TCNNGA 1 cut(s) 603
Hpy8I GTNNAC 2 cut(s) 188, 364
HpyAV CCTTC 3 cut(s) 51, 382, 494
HpyCH4III ACNGT 2 cut(s) 264, 593
HpyCH4IV ACGT 2 cut(s) 190, 225
HpyCH4V TGCA 6 cut(s) 17, 29, 215, 364, 383, 611
HpyF10VI GCNNNNNNNGC 8 cut(s) 104, 377, 425, 449, 458, 632, 635, 641
HpyF3I CTNAG 3 cut(s) 303, 346, 601
HpySE526I ACGT 2 cut(s) 190, 225
Hsp92I GRCGYC 1 cut(s) 190
Hsp92II CATG 7 cut(s) 51, 79, 148, 256, 371, 469, 538
Kzo9I GATC 3 cut(s) 276, 597, 605
LmnI GCTCC 1 cut(s) 332
Lsp1109I GCAGC 3 cut(s) 367, 525, 647
LweI GCATC 1 cut(s) 392
MaeI CTAG 2 cut(s) 326, 679
MaeII ACGT 2 cut(s) 190, 225
MaeIII GTNAC 2 cut(s) 71, 221
MalI GATC 3 cut(s) 278, 599, 607
MboI GATC 3 cut(s) 276, 597, 605
MboII GAAGA 3 cut(s) 185, 300, 403
MflI RGATCY 2 cut(s) 597, 605
MhlI GDGCHC 1 cut(s) 366
MluCI AATT 3 cut(s) 154, 175, 555
MnlI CCTC 3 cut(s) 117, 512, 577
MseI TTAA 3 cut(s) 170, 456, 572
MspCI CTTAAG 1 cut(s) 571
MspR9I CCNGG 3 cut(s) 377, 432, 646
MvaI CCWGG 3 cut(s) 377, 432, 646
MwoI GCNNNNNNNGC 8 cut(s) 104, 377, 425, 449, 458, 632, 635, 641
NdeI CATATG 1 cut(s) 31
NdeII GATC 3 cut(s) 276, 597, 605
NlaIII CATG 7 cut(s) 51, 79, 148, 256, 371, 469, 538
NlaIV GGNNCC 1 cut(s) 429
NmuCI GTSAC 2 cut(s) 71, 221
NspV TTCGAA 1 cut(s) 658
PcsI WCGNNNNNNNCGW 1 cut(s) 664
PfeI GAWTC 2 cut(s) 394, 546
PflMI CCANNNNNTGG 1 cut(s) 645
PkrI GCNGC 4 cut(s) 382, 540, 628, 637
PsiI TTATAA 1 cut(s) 518
Psp6I CCWGG 3 cut(s) 375, 430, 644
PspFI CCCAGC 1 cut(s) 541
PspGI CCWGG 3 cut(s) 375, 430, 644
PspN4I GGNNCC 1 cut(s) 429
PspPI GGNCC 2 cut(s) 299, 427
PstNI CAGNNNCTG 2 cut(s) 530, 608
PsuI RGATCY 2 cut(s) 597, 605
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 3 cut(s) 170, 456, 572
SatI GCNGC 4 cut(s) 381, 539, 627, 636
Sau3AI GATC 3 cut(s) 276, 597, 605
Sau96I GGNCC 2 cut(s) 299, 427
ScrFI CCNGG 3 cut(s) 377, 432, 646
SduI GDGCHC 1 cut(s) 366
SetI ASST 7 cut(s) 62, 100, 193, 228, 331, 337, 499
SfaNI GCATC 1 cut(s) 392
SfcI CTRYAG 1 cut(s) 37
SfuI TTCGAA 1 cut(s) 658
SmlI CTYRAG 1 cut(s) 571
SmoI CTYRAG 1 cut(s) 571
Sse9I AATT 3 cut(s) 154, 175, 555
SsiI CCGC 4 cut(s) 69, 447, 621, 626
SspI AATATT 1 cut(s) 283
SspMI CTAG 2 cut(s) 326, 679
StyD4I CCNGG 3 cut(s) 375, 430, 644
StyI CCWWGG 1 cut(s) 423
TaaI ACNGT 2 cut(s) 264, 593
TaiI ACGT 2 cut(s) 193, 228
TaqI TCGA 3 cut(s) 389, 397, 658
TasI AATT 3 cut(s) 154, 175, 555
TatI WGTACW 1 cut(s) 147
TauI GCSGC 1 cut(s) 629
TfiI GAWTC 2 cut(s) 394, 546
Tru1I TTAA 3 cut(s) 170, 456, 572
Tru9I TTAA 3 cut(s) 170, 456, 572
TseFI GTSAC 2 cut(s) 71, 221
TseI GCWGC 3 cut(s) 380, 538, 635
Tsp45I GTSAC 2 cut(s) 71, 221
TspDTI ATGAA 1 cut(s) 133
Van91I CCANNNNNTGG 1 cut(s) 645
Vha464I CTTAAG 1 cut(s) 571
VneI GTGCAC 1 cut(s) 362
XapI RAATTY 1 cut(s) 154
XspI CTAG 2 cut(s) 326, 679
ZraI GACGTC 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.