Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8273229.1

Orthogroup ID

OG0001329

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 743

Gene Structure 743 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8273229.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 236 bp

atggttttgggattggttgtagctaatgttgctgtttttcttttatggaggatagcagaccctatattcatgtacaagaattttactatctcattaaacaattttacaagtggacgtcttcacacattgataacttctgcatttagtcacgttgatatttggcatatcatttctaacatgattggactgtatttttttgggatcaatattggaagaacttttgggcctgagttttt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rhomboid

Protein Analysis

78

Amino Acids

8.88

Weight (kDa)

8.31

Isoelectric Point (pI)

25.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001329)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G18600
fragaria_vesca	FvH4_5g13610 FvH4_5g13610 FvH4_5g13610 FvH4_5g13620 FvH4_5g13640 FvH4_5g13640 FvH4_5g13640 FvH4_5g13640
malus_domestica	MD14G1214000.v1.1
prunus_persica	Prupe.3G124800_v2.0.a1 Prupe.3G124800_v2.0.a1 Prupe.3G124800_v2.0.a1 Prupe.5G207200_v2.0.a1 Prupe.5G207200_v2.0.a1 Prupe.5G207200_v2.0.a1 Prupe.5G207300_v2.0.a1
pyrus_communis	pycom14g17740 pycom16g17930
rosa_chinensis	RchiOBHm_Chr1g0346931 RchiOBHm_Chr1g0346941 RchiOBHm_Chr6g0258631 RchiOBHm_Chr6g0258651 RchiOBHm_Chr7g0183321 RchiOBHm_Chr7g0183341 RchiOBHm_Chr7g0198541
rosa_laevigata	RLG00000005055 RLG00000005057 RLG00000024525
rosa_multiflora	Rmu_co8273229.1_g000001 Rmu_sc0008602.1_g000004
rosa_roxburghii	Rroxscaffold_2G00110010 Rroxscaffold_3G00270550 Rroxscaffold_3G00270560
rosa_rugosa	Rorug03G0286600.1 Rorug04G0408600 Rorug06G0456400 Rorug06G0456500 Rorug06G0456600 Rorug06G0456600 Rorug06G0456800 Rorug07G0030500
rosa_samantha	Rh7AG058100 Rh7AG058300 Rh7BG057900 Rh7BG058200 Rh7CG059500 Rh7CG059700 Rh7CG059800 Rh7CG059900 Rh7DG057800 Rh7DG058000
rosa_wichuraiana	Rw7G004770 Rw7G004790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	118
AclWI	GGATC	1 cut(s)	209
AcsI	RAATTY	1 cut(s)	79
AcyI	GRCGYC	1 cut(s)	115
AfaI	GTAC	1 cut(s)	74
AluBI	AGCT	1 cut(s)	23
AluI	AGCT	1 cut(s)	23
AlwI	GGATC	1 cut(s)	209
AoxI	GGCC	1 cut(s)	224
ApoI	RAATTY	1 cut(s)	79
AspS9I	GGNCC	1 cut(s)	224
BbsI	GAAGAC	1 cut(s)	110
BmgT120I	GGNCC	1 cut(s)	224
BpiI	GAAGAC	1 cut(s)	110
BsaHI	GRCGYC	1 cut(s)	115
BseMII	CTCAG	1 cut(s)	219
BshFI	GGCC	1 cut(s)	226
BsnI	GGCC	1 cut(s)	226
Bsp1407I	TGTACA	1 cut(s)	72
Bsp143I	GATC	1 cut(s)	201
BspANI	GGCC	1 cut(s)	226
BspCNI	CTCAG	1 cut(s)	220
BspPI	GGATC	1 cut(s)	209
BsrGI	TGTACA	1 cut(s)	72
BssMI	GATC	1 cut(s)	201
BssNI	GRCGYC	1 cut(s)	115
Bst4CI	ACNGT	1 cut(s)	189
BstACI	GRCGYC	1 cut(s)	115
BstAUI	TGTACA	1 cut(s)	72
BstDEI	CTNAG	1 cut(s)	228
BstKTI	GATC	1 cut(s)	204
BstMBI	GATC	1 cut(s)	201
BstMWI	GCNNNNNNNGC	1 cut(s)	29
BstV2I	GAAGAC	1 cut(s)	110
BsuRI	GGCC	1 cut(s)	226
Cfr13I	GGNCC	1 cut(s)	224
Csp6I	GTAC	1 cut(s)	73
CviAII	CATG	2 cut(s)	70, 178
CviJI	RGCY	2 cut(s)	23, 226
CviKI_1	RGCY	2 cut(s)	23, 226
CviQI	GTAC	1 cut(s)	73
DdeI	CTNAG	1 cut(s)	228
DpnI	GATC	1 cut(s)	203
DpnII	GATC	1 cut(s)	201
FaeI	CATG	2 cut(s)	73, 181
FaiI	YATR	5 cut(s)	46, 65, 71, 165, 179
FatI	CATG	2 cut(s)	69, 177
HaeIII	GGCC	1 cut(s)	226
Hin1I	GRCGYC	1 cut(s)	115
Hin1II	CATG	2 cut(s)	73, 181
Hpy166II	GTNNAC	1 cut(s)	113
Hpy8I	GTNNAC	1 cut(s)	113
HpyCH4III	ACNGT	1 cut(s)	189
HpyCH4IV	ACGT	2 cut(s)	115, 150
HpyCH4V	TGCA	1 cut(s)	140
HpyF10VI	GCNNNNNNNGC	1 cut(s)	29
HpyF3I	CTNAG	1 cut(s)	228
HpySE526I	ACGT	2 cut(s)	115, 150
Hsp92I	GRCGYC	1 cut(s)	115
Hsp92II	CATG	2 cut(s)	73, 181
Kzo9I	GATC	1 cut(s)	201
MaeII	ACGT	2 cut(s)	115, 150
MaeIII	GTNAC	1 cut(s)	146
MalI	GATC	1 cut(s)	203
MboI	GATC	1 cut(s)	201
MboII	GAAGA	2 cut(s)	110, 225
MluCI	AATT	2 cut(s)	79, 100
MnlI	CCTC	1 cut(s)	42
MseI	TTAA	1 cut(s)	95
MwoI	GCNNNNNNNGC	1 cut(s)	29
NdeII	GATC	1 cut(s)	201
NlaIII	CATG	2 cut(s)	73, 181
NmuCI	GTSAC	1 cut(s)	146
PspPI	GGNCC	1 cut(s)	224
RsaI	GTAC	1 cut(s)	74
RsaNI	GTAC	1 cut(s)	73
SaqAI	TTAA	1 cut(s)	95
Sau3AI	GATC	1 cut(s)	201
Sau96I	GGNCC	1 cut(s)	224
SetI	ASST	3 cut(s)	25, 118, 153
SgeI	CNNG	5 cut(s)	82, 88, 120, 161, 190
Sse9I	AATT	2 cut(s)	79, 100
SspI	AATATT	1 cut(s)	208
TaaI	ACNGT	1 cut(s)	189
TaiI	ACGT	2 cut(s)	118, 153
TasI	AATT	2 cut(s)	79, 100
TatI	WGTACW	1 cut(s)	72
Tru1I	TTAA	1 cut(s)	95
Tru9I	TTAA	1 cut(s)	95
TseFI	GTSAC	1 cut(s)	146
Tsp45I	GTSAC	1 cut(s)	146
TspDTI	ATGAA	1 cut(s)	58
XapI	RAATTY	1 cut(s)	79
ZraI	GACGTC	1 cut(s)	116

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.