RchiOBHm_Chr7g0239751

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
65513808 .. 65515495
1688 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21488

Sequence Viewer

Length: 228 bp
ATGTTGATTCCTTCAAGTGGCGACGCTTTTGCTGATAACCACCCACGGCGAAGCCGCAAGGTCGTAGACGACGACTCCGACGACTTTGTTGACGACCTTGATTCGAGCAAGGTGAAGACTGATACTTCGGCTTTGGAAGCTAGAAATGGAAAAGACATACAGGAAATACCATGGGAGAGGCTTAATTTCACCAGAGATAAGTACAATGAAGCGCGATTGAAGCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.64

Weight (kDa)

4.83

Isoelectric Point (pI)

27.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 66
AccII CGCG 1 cut(s) 214
AciI CCGC 1 cut(s) 55
AfaI GTAC 1 cut(s) 203
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 2 cut(s) 15, 220
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
ArsI GACNNNNNNTTYG 2 cut(s) 109, 141
AspLEI GCGC 1 cut(s) 214
AsuHPI GGTGA 2 cut(s) 124, 181
BbsI GAAGAC 1 cut(s) 122
BceAI ACGGC 1 cut(s) 62
BcgI CGANNNNNNTGC 2 cut(s) 11, 45
BfaI CTAG 1 cut(s) 141
BisI GCNGC 1 cut(s) 55
BlsI GCNGC 1 cut(s) 56
BpiI GAAGAC 1 cut(s) 122
BsaJI CCNNGG 2 cut(s) 44, 170
BsaXI ACNNNNNCTCC 2 cut(s) 59, 89
Bsc4I CCNNNNNNNGG 1 cut(s) 17
BseDI CCNNGG 2 cut(s) 44, 170
BseLI CCNNNNNNNGG 1 cut(s) 17
Bsh1236I CGCG 1 cut(s) 214
BslI CCNNNNNNNGG 1 cut(s) 17
Bsp19I CCATGG 1 cut(s) 170
BspACI CCGC 1 cut(s) 55
BspFNI CGCG 1 cut(s) 214
BssECI CCNNGG 2 cut(s) 44, 170
BssT1I CCWWGG 1 cut(s) 170
BstDSI CCRYGG 2 cut(s) 44, 170
BstFNI CGCG 1 cut(s) 214
BstHHI GCGC 1 cut(s) 214
BstMWI GCNNNNNNNGC 2 cut(s) 137, 220
BstUI CGCG 1 cut(s) 214
BstV2I GAAGAC 1 cut(s) 122
BtgI CCRYGG 2 cut(s) 44, 170
CfoI GCGC 1 cut(s) 214
CseI GACGC 1 cut(s) 32
Csp6I GTAC 1 cut(s) 202
CviAII CATG 1 cut(s) 171
CviJI RGCY 4 cut(s) 54, 131, 140, 181
CviKI_1 RGCY 4 cut(s) 54, 131, 140, 181
CviQI GTAC 1 cut(s) 202
Eco130I CCWWGG 1 cut(s) 170
EcoT14I CCWWGG 1 cut(s) 170
ErhI CCWWGG 1 cut(s) 170
FaeI CATG 1 cut(s) 174
FaiI YATR 2 cut(s) 158, 172
FatI CATG 1 cut(s) 170
FblI GTMKAC 1 cut(s) 66
Fnu4HI GCNGC 1 cut(s) 55
Fsp4HI GCNGC 1 cut(s) 55
FspBI CTAG 1 cut(s) 141
GlaI GCGC 1 cut(s) 213
GluI GCNGC 1 cut(s) 55
HgaI GACGC 1 cut(s) 32
HhaI GCGC 1 cut(s) 214
Hin1II CATG 1 cut(s) 174
Hin6I GCGC 1 cut(s) 212
HinP1I GCGC 1 cut(s) 212
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
HinfI GANTC 3 cut(s) 7, 74, 101
HphI GGTGA 2 cut(s) 124, 181
Hpy166II GTNNAC 2 cut(s) 67, 91
Hpy188I TCNGA 1 cut(s) 79
Hpy8I GTNNAC 2 cut(s) 67, 91
Hpy99I CGWCG 3 cut(s) 26, 74, 83
HpyAV CCTTC 1 cut(s) 21
HpyF10VI GCNNNNNNNGC 2 cut(s) 137, 220
Hsp92II CATG 1 cut(s) 174
HspAI GCGC 1 cut(s) 212
LpnPI CCDG 2 cut(s) 146, 205
MaeI CTAG 1 cut(s) 141
MboII GAAGA 1 cut(s) 127
MluCI AATT 1 cut(s) 184
MlyI GAGTC 1 cut(s) 68
MmeI TCCRAC 1 cut(s) 102
MnlI CCTC 1 cut(s) 171
MseI TTAA 1 cut(s) 183
MvnI CGCG 1 cut(s) 214
MwoI GCNNNNNNNGC 2 cut(s) 137, 220
NcoI CCATGG 1 cut(s) 170
NlaIII CATG 1 cut(s) 174
PcsI WCGNNNNNNNCGW 3 cut(s) 69, 75, 78
PfeI GAWTC 2 cut(s) 7, 101
PkrI GCNGC 1 cut(s) 56
PleI GAGTC 1 cut(s) 68
PpsI GAGTC 1 cut(s) 68
RsaI GTAC 1 cut(s) 203
RsaNI GTAC 1 cut(s) 202
SaqAI TTAA 1 cut(s) 183
SatI GCNGC 1 cut(s) 55
SchI GAGTC 1 cut(s) 68
SetI ASST 4 cut(s) 63, 99, 114, 142
Sse9I AATT 1 cut(s) 184
SsiI CCGC 1 cut(s) 55
SspMI CTAG 1 cut(s) 141
StyI CCWWGG 1 cut(s) 170
TaqI TCGA 1 cut(s) 104
TasI AATT 1 cut(s) 184
TatI WGTACW 1 cut(s) 201
TauI GCSGC 1 cut(s) 57
TfiI GAWTC 2 cut(s) 7, 101
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TspDTI ATGAA 1 cut(s) 222
XmiI GTMKAC 1 cut(s) 66
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.