Rh5AG442100

Domain of unknown function (DUF4378)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
75852875 .. 75857451
4577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG442100.1

Sequence Viewer

Length: 267 bp
ATGGCTGCAAAACTTCTGCATTCTTTAGCTGATGACAACCCAGATTTGCAGAAGCAAATAGGATGCATGAATGGGAGTTTCCATATTTTCGATCGACACCAAGTCCTCACTGGTAGGAGGATTAGCCACCACAAGAGGCTTCCTCCAGGGAATTCACACTATAGCAATGGTGGCCTGGAAAGAGACTCCAACAATCCATACCATCGGCAAGCAGTAACTGTAATCACTCTCTACTCAATGATTCCTTTCCTTTTAGCAAATTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.94

Weight (kDa)

9.18

Isoelectric Point (pI)

49.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 151
AhdI GACNNNNNGTC 1 cut(s) 101
AjnI CCWGG 2 cut(s) 145, 174
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
Alw26I GTCTC 1 cut(s) 177
AlwNI CAGNNNCTG 1 cut(s) 218
AoxI GGCC 1 cut(s) 172
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 151
BccI CCATC 1 cut(s) 210
BciT130I CCWGG 2 cut(s) 147, 176
BcoDI GTCTC 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 160
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 2 cut(s) 147, 176
BmeRI GACNNNNNGTC 1 cut(s) 101
BmrFI CCNGG 2 cut(s) 147, 176
BmsI GCATC 1 cut(s) 53
BplI GAGNNNNNCTC 2 cut(s) 127, 159
BpmI CTGGAG 1 cut(s) 129
BsaJI CCNNGG 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 115
Bse3DI GCAATG 1 cut(s) 172
BseBI CCWGG 2 cut(s) 147, 176
BseDI CCNNGG 1 cut(s) 146
BseGI GGATG 1 cut(s) 68
BseMI GCAATG 1 cut(s) 172
BseNI ACTGG 1 cut(s) 115
Bsh1285I CGRYCG 1 cut(s) 94
BshFI GGCC 1 cut(s) 174
BsiEI CGRYCG 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 177
BsmI GAATGC 1 cut(s) 19
BsnI GGCC 1 cut(s) 174
Bsp143I GATC 1 cut(s) 91
BspANI GGCC 1 cut(s) 174
BsrDI GCAATG 1 cut(s) 172
BsrI ACTGG 1 cut(s) 115
BssECI CCNNGG 1 cut(s) 146
BssMI GATC 1 cut(s) 91
Bst2UI CCWGG 2 cut(s) 147, 176
Bst4CI ACNGT 1 cut(s) 220
BstC8I GCNNGC 1 cut(s) 210
BstF5I GGATG 1 cut(s) 68
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 177
BstMBI GATC 1 cut(s) 91
BstMCI CGRYCG 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 171
BstNI CCWGG 2 cut(s) 147, 176
BstSCI CCNGG 2 cut(s) 145, 174
BstSFI CTRYAG 1 cut(s) 160
BsuRI GGCC 1 cut(s) 174
BtsCI GGATG 1 cut(s) 68
BtsIMutI CAGTG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 210
CaiI CAGNNNCTG 1 cut(s) 218
CviAII CATG 1 cut(s) 67
CviJI RGCY 5 cut(s) 5, 29, 126, 139, 174
CviKI_1 RGCY 5 cut(s) 5, 29, 126, 139, 174
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
DriI GACNNNNNGTC 1 cut(s) 101
Eam1105I GACNNNNNGTC 1 cut(s) 101
EcoRI GAATTC 1 cut(s) 151
EcoRII CCWGG 2 cut(s) 145, 174
EcoT22I ATGCAT 1 cut(s) 68
FaeI CATG 1 cut(s) 70
FaiI YATR 4 cut(s) 68, 84, 162, 199
FatI CATG 1 cut(s) 66
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 1 cut(s) 75
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 174
Hin1II CATG 1 cut(s) 70
HinfI GANTC 2 cut(s) 185, 241
HpyCH4III ACNGT 1 cut(s) 220
HpyCH4V TGCA 4 cut(s) 8, 19, 49, 66
HpyF10VI GCNNNNNNNGC 1 cut(s) 171
Hsp92II CATG 1 cut(s) 70
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 6 cut(s) 54, 96, 132, 159, 161, 188
LweI GCATC 1 cut(s) 53
MaeIII GTNAC 1 cut(s) 214
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 2 cut(s) 151, 259
MlyI GAGTC 1 cut(s) 179
MmeI TCCRAC 1 cut(s) 213
MnlI CCTC 4 cut(s) 111, 116, 129, 153
Mph1103I ATGCAT 1 cut(s) 68
MspR9I CCNGG 2 cut(s) 147, 176
Mva1269I GAATGC 1 cut(s) 19
MvaI CCWGG 2 cut(s) 147, 176
MwoI GCNNNNNNNGC 1 cut(s) 171
NdeII GATC 1 cut(s) 91
NlaIII CATG 1 cut(s) 70
NsiI ATGCAT 1 cut(s) 68
PctI GAATGC 1 cut(s) 19
PfeI GAWTC 1 cut(s) 241
PkrI GCNGC 1 cut(s) 7
Ple19I CGATCG 1 cut(s) 94
PleI GAGTC 1 cut(s) 179
PpsI GAGTC 1 cut(s) 179
Psp6I CCWGG 2 cut(s) 145, 174
PspGI CCWGG 2 cut(s) 145, 174
PstNI CAGNNNCTG 1 cut(s) 218
PvuI CGATCG 1 cut(s) 94
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 91
SchI GAGTC 1 cut(s) 179
ScrFI CCNGG 2 cut(s) 147, 176
SetI ASST 1 cut(s) 31
SfaNI GCATC 1 cut(s) 53
SfcI CTRYAG 1 cut(s) 160
Sse9I AATT 2 cut(s) 151, 259
StyD4I CCNGG 2 cut(s) 145, 174
TaaI ACNGT 1 cut(s) 220
TaqI TCGA 2 cut(s) 90, 94
TasI AATT 2 cut(s) 151, 259
TfiI GAWTC 1 cut(s) 241
TscAI CASTG 1 cut(s) 115
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 83
TspRI CASTG 1 cut(s) 115
XapI RAATTY 1 cut(s) 151
XcmI CCANNNNNNNNNTGG 1 cut(s) 107
Zsp2I ATGCAT 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.