Rh2AG507000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0001770
Physical Location & Seq
Forward (+)
72939667 .. 72939820
154 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG507000.1

Sequence Viewer

Length: 154 bp
ATGGATTCGGAGCCTTTCGCGAGAGAAAAGAACGGGACTTTTCTGGGGATGATGTACCAGCTCCTCCCACACAATACCAGATCCAAGAGATCAACTGCCTCACTCTCGCCTCTTCGTTGTCTCCGGCCTCGGCCTCCTCTATGCTCTCCACCGC
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.79

Weight (kDa)

10.29

Isoelectric Point (pI)

99.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 20
AciI CCGC 1 cut(s) 152
AclWI GGATC 1 cut(s) 75
AfaI GTAC 1 cut(s) 56
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
Alw26I GTCTC 1 cut(s) 125
AlwI GGATC 1 cut(s) 75
AoxI GGCC 2 cut(s) 125, 131
BcoDI GTCTC 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 54
BseRI GAGGAG 2 cut(s) 53, 126
Bsh1236I CGCG 1 cut(s) 20
BshFI GGCC 2 cut(s) 127, 133
BsiSI CCGG 1 cut(s) 124
BslFI GGGAC 1 cut(s) 49
BsmAI GTCTC 1 cut(s) 125
BsmFI GGGAC 1 cut(s) 49
BsnI GGCC 2 cut(s) 127, 133
Bsp143I GATC 2 cut(s) 80, 89
Bsp68I TCGCGA 1 cut(s) 20
BspACI CCGC 1 cut(s) 152
BspANI GGCC 2 cut(s) 127, 133
BspFNI CGCG 1 cut(s) 20
BspLI GGNNCC 1 cut(s) 12
BspPI GGATC 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 128
BssMI GATC 2 cut(s) 80, 89
Bst6I CTCTTC 1 cut(s) 117
BstF5I GGATG 1 cut(s) 54
BstFNI CGCG 1 cut(s) 20
BstKTI GATC 2 cut(s) 83, 92
BstMAI GTCTC 1 cut(s) 125
BstMBI GATC 2 cut(s) 80, 89
BstUI CGCG 1 cut(s) 20
BstX2I RGATCY 1 cut(s) 80
BstYI RGATCY 1 cut(s) 80
BsuRI GGCC 2 cut(s) 127, 133
BtsCI GGATG 1 cut(s) 54
BtuMI TCGCGA 1 cut(s) 20
Csp6I GTAC 1 cut(s) 55
CviJI RGCY 4 cut(s) 13, 61, 127, 133
CviKI_1 RGCY 4 cut(s) 13, 61, 127, 133
CviQI GTAC 1 cut(s) 55
DpnI GATC 2 cut(s) 82, 91
DpnII GATC 2 cut(s) 80, 89
Eam1104I CTCTTC 1 cut(s) 117
EarI CTCTTC 1 cut(s) 117
FaiI YATR 1 cut(s) 142
FaqI GGGAC 1 cut(s) 49
FokI GGATG 1 cut(s) 61
HaeIII GGCC 2 cut(s) 127, 133
HapII CCGG 1 cut(s) 124
HinfI GANTC 1 cut(s) 5
HpaII CCGG 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 19
Kzo9I GATC 2 cut(s) 80, 89
LmnI GCTCC 2 cut(s) 10, 66
LpnPI CCDG 4 cut(s) 29, 71, 91, 137
MalI GATC 2 cut(s) 82, 91
MboI GATC 2 cut(s) 80, 89
MboII GAAGA 1 cut(s) 104
MflI RGATCY 1 cut(s) 80
MnlI CCTC 6 cut(s) 74, 109, 120, 138, 144, 147
MspI CCGG 1 cut(s) 124
MvnI CGCG 1 cut(s) 20
NdeII GATC 2 cut(s) 80, 89
NlaIV GGNNCC 1 cut(s) 12
NmeAIII GCCGAG 1 cut(s) 109
NruI TCGCGA 1 cut(s) 20
PfeI GAWTC 1 cut(s) 5
PspN4I GGNNCC 1 cut(s) 12
PsuI RGATCY 1 cut(s) 80
RruI TCGCGA 1 cut(s) 20
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
Sau3AI GATC 2 cut(s) 80, 89
SetI ASST 1 cut(s) 63
SsiI CCGC 1 cut(s) 152
TfiI GAWTC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.