Rroxscaffold_2G00120160

Splicing factor 3B subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
52262977 .. 52263550
574 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00120160.1

Sequence Viewer

Length: 168 bp
ATGTTGATTGGGGGACATAGGCATAATTGGGACCTGGTGTGGGATGCAACTGCAGCTGATCCTAAATTGCTGGTCTTTTTGAAATCGTACAGGAATTTCTTACACACCGAATCTGGCCAGGAATTTCTTACTAGTAATAGGTGTTTGGCAAAAGTCACCCTTGATTGA

Protein Analysis

55

Amino Acids

6.33

Weight (kDa)

6.81

Isoelectric Point (pI)

19.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 53
AcoI YGGCCR 1 cut(s) 115
AcsI RAATTY 2 cut(s) 94, 122
AfaI GTAC 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 1 cut(s) 82
AhlI ACTAGT 1 cut(s) 131
AjnI CCWGG 2 cut(s) 33, 117
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
AlwI GGATC 1 cut(s) 53
AoxI GGCC 1 cut(s) 115
ApeKI GCWGC 1 cut(s) 53
ApoI RAATTY 2 cut(s) 94, 122
AspS9I GGNCC 1 cut(s) 31
AsuHPI GGTGA 1 cut(s) 148
AvaII GGWCC 1 cut(s) 31
BalI TGGCCA 1 cut(s) 117
BbvI GCAGC 1 cut(s) 65
BciT130I CCWGG 2 cut(s) 35, 119
BcuI ACTAGT 1 cut(s) 131
BfaI CTAG 1 cut(s) 132
BfmI CTRYAG 1 cut(s) 51
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 2 cut(s) 35, 119
Bme18I GGWCC 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 31
BmiI GGNNCC 1 cut(s) 32
BmrFI CCNGG 2 cut(s) 35, 119
BmsI GCATC 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseBI CCWGG 2 cut(s) 35, 119
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 40
BseXI GCAGC 1 cut(s) 65
BshFI GGCC 1 cut(s) 117
BslFI GGGAC 2 cut(s) 27, 44
BslI CCNNNNNNNGG 1 cut(s) 40
BsmFI GGGAC 2 cut(s) 27, 44
BsnI GGCC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 58
BspANI GGCC 1 cut(s) 117
BspLI GGNNCC 1 cut(s) 32
BspMAI CTGCAG 1 cut(s) 55
BspPI GGATC 1 cut(s) 53
BssMI GATC 1 cut(s) 58
Bst2UI CCWGG 2 cut(s) 35, 119
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNI CCWGG 2 cut(s) 35, 119
BstSCI CCNGG 2 cut(s) 33, 117
BstSFI CTRYAG 1 cut(s) 51
BstV1I GCAGC 1 cut(s) 65
BsuRI GGCC 1 cut(s) 117
BtsCI GGATG 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 31
CsiI ACCWGGT 1 cut(s) 33
Csp6I GTAC 1 cut(s) 88
CviJI RGCY 2 cut(s) 56, 117
CviKI_1 RGCY 2 cut(s) 56, 117
CviQI GTAC 1 cut(s) 88
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
EaeI YGGCCR 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 31
EcoO109I RGGNCCY 1 cut(s) 31
EcoRII CCWGG 2 cut(s) 33, 117
FaiI YATR 2 cut(s) 18, 24
FalI AAGNNNNNCTT 1 cut(s) 144
FaqI GGGAC 2 cut(s) 27, 44
Fnu4HI GCNGC 1 cut(s) 54
FokI GGATG 1 cut(s) 56
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 1 cut(s) 132
GluI GCNGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 117
HinfI GANTC 1 cut(s) 110
HphI GGTGA 1 cut(s) 148
HpyCH4V TGCA 2 cut(s) 47, 53
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 7 cut(s) 20, 47, 56, 76, 99, 104, 131
Lsp1109I GCAGC 1 cut(s) 65
LweI GCATC 1 cut(s) 34
MabI ACCWGGT 1 cut(s) 33
MaeI CTAG 1 cut(s) 132
MaeIII GTNAC 1 cut(s) 154
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MlsI TGGCCA 1 cut(s) 117
MluCI AATT 4 cut(s) 25, 65, 94, 122
MluNI TGGCCA 1 cut(s) 117
Mox20I TGGCCA 1 cut(s) 117
MscI TGGCCA 1 cut(s) 117
Msp20I TGGCCA 1 cut(s) 117
MspA1I CMGCKG 1 cut(s) 56
MspR9I CCNGG 2 cut(s) 35, 119
MvaI CCWGG 2 cut(s) 35, 119
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 1 cut(s) 58
NlaIV GGNNCC 1 cut(s) 32
NmuCI GTSAC 1 cut(s) 154
PfeI GAWTC 1 cut(s) 110
PkrI GCNGC 1 cut(s) 55
PpuMI RGGWCCY 1 cut(s) 31
Psp5II RGGWCCY 1 cut(s) 31
Psp6I CCWGG 2 cut(s) 33, 117
PspGI CCWGG 2 cut(s) 33, 117
PspN4I GGNNCC 1 cut(s) 32
PspPI GGNCC 1 cut(s) 31
PspPPI RGGWCCY 1 cut(s) 31
PstI CTGCAG 1 cut(s) 55
PvuII CAGCTG 1 cut(s) 56
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 1 cut(s) 31
ScrFI CCNGG 2 cut(s) 35, 119
SetI ASST 3 cut(s) 36, 58, 143
SexAI ACCWGGT 1 cut(s) 33
SfaNI GCATC 1 cut(s) 34
SfcI CTRYAG 1 cut(s) 51
SgeI CNNG 8 cut(s) 46, 47, 83, 103, 126, 130, 131, 144
SinI GGWCC 1 cut(s) 31
SpeI ACTAGT 1 cut(s) 131
Sse9I AATT 4 cut(s) 25, 65, 94, 122
SspMI CTAG 1 cut(s) 132
StyD4I CCNGG 2 cut(s) 33, 117
TasI AATT 4 cut(s) 25, 65, 94, 122
TfiI GAWTC 1 cut(s) 110
TseFI GTSAC 1 cut(s) 154
TseI GCWGC 1 cut(s) 53
Tsp45I GTSAC 1 cut(s) 154
VpaK11BI GGWCC 1 cut(s) 31
XapI RAATTY 2 cut(s) 94, 122
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.