RchiOBHm_Chr7g0240001

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
65789051 .. 65789453
403 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21513

Sequence Viewer

Length: 249 bp
ATGGATTCGCCCCTGGTTGAGTTTGAGGAAGACAACGACACTTTTGCTGATAAACAGCCCCGCCCAAGCCTCGAGGTCGACGACGACGATGACCTTGATTCGAGCAAGGTGAAGAGTGATAAATCGGCTTTGGAAGCTAGAAATGGAAAGGATATACAGGGAATACCATGGGAGAGGCTTAATTTCACCAGAGATAAGTACTGTTGTATGAGAGTGCTTGCAAGTGGAGAAGGGGAAAAGTTTCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.36

Weight (kDa)

4.34

Isoelectric Point (pI)

26.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 71
AccI GTMKAC 1 cut(s) 78
AciI CCGC 1 cut(s) 61
AfaI GTAC 1 cut(s) 200
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
Ama87I CYCGRG 1 cut(s) 71
Asp700I GAANNNNTTC 1 cut(s) 240
AsuHPI GGTGA 2 cut(s) 121, 178
AvaI CYCGRG 1 cut(s) 71
BbsI GAAGAC 1 cut(s) 36
BcgI CGANNNNNNTGC 2 cut(s) 26, 60
BciT130I CCWGG 1 cut(s) 14
BfaI CTAG 1 cut(s) 138
BmcAI AGTACT 1 cut(s) 200
Bme1390I CCNGG 1 cut(s) 14
BmeT110I CYCGRG 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 14
BpiI GAAGAC 1 cut(s) 36
BsaJI CCNNGG 2 cut(s) 12, 167
BseBI CCWGG 1 cut(s) 14
BseDI CCNNGG 2 cut(s) 12, 167
BsiHKCI CYCGRG 1 cut(s) 71
BsoBI CYCGRG 1 cut(s) 71
Bsp19I CCATGG 1 cut(s) 167
BspACI CCGC 1 cut(s) 61
BssECI CCNNGG 2 cut(s) 12, 167
BssT1I CCWWGG 1 cut(s) 167
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 203
Bst6I CTCTTC 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 219
BstDSI CCRYGG 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNI CCWGG 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 12
BstV2I GAAGAC 1 cut(s) 36
BtgI CCRYGG 1 cut(s) 167
Cac8I GCNNGC 1 cut(s) 219
Csp6I GTAC 1 cut(s) 199
CviAII CATG 1 cut(s) 168
CviJI RGCY 5 cut(s) 58, 69, 128, 137, 178
CviKI_1 RGCY 5 cut(s) 58, 69, 128, 137, 178
CviQI GTAC 1 cut(s) 199
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
Eco130I CCWWGG 1 cut(s) 167
Eco88I CYCGRG 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 12
EcoT14I CCWWGG 1 cut(s) 167
ErhI CCWWGG 1 cut(s) 167
FaeI CATG 1 cut(s) 171
FaiI YATR 4 cut(s) 155, 169, 209, 247
FatI CATG 1 cut(s) 167
FauI CCCGC 1 cut(s) 68
FblI GTMKAC 1 cut(s) 78
FspBI CTAG 1 cut(s) 138
Hin1II CATG 1 cut(s) 171
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HinfI GANTC 2 cut(s) 5, 98
HphI GGTGA 2 cut(s) 121, 178
Hpy166II GTNNAC 1 cut(s) 79
Hpy8I GTNNAC 1 cut(s) 79
Hpy99I CGWCG 3 cut(s) 83, 86, 89
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 1 cut(s) 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
Hsp92II CATG 1 cut(s) 171
LpnPI CCDG 3 cut(s) 26, 143, 202
MaeI CTAG 1 cut(s) 138
MboII GAAGA 2 cut(s) 41, 124
MluCI AATT 1 cut(s) 181
MnlI CCTC 4 cut(s) 19, 67, 80, 168
MroXI GAANNNNTTC 1 cut(s) 240
MseI TTAA 1 cut(s) 180
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 134
NcoI CCATGG 1 cut(s) 167
NlaIII CATG 1 cut(s) 171
PaeR7I CTCGAG 1 cut(s) 71
PcsI WCGNNNNNNNCGW 2 cut(s) 78, 84
PdmI GAANNNNTTC 1 cut(s) 240
PfeI GAWTC 2 cut(s) 5, 98
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PspXI VCTCGAGB 1 cut(s) 71
RsaI GTAC 1 cut(s) 200
RsaNI GTAC 1 cut(s) 199
SalI GTCGAC 1 cut(s) 77
SaqAI TTAA 1 cut(s) 180
ScaI AGTACT 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 14
SetI ASST 4 cut(s) 78, 96, 111, 139
Sfr274I CTCGAG 1 cut(s) 71
SlaI CTCGAG 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
Sse9I AATT 1 cut(s) 181
SsiI CCGC 1 cut(s) 61
SspMI CTAG 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 12
StyI CCWWGG 1 cut(s) 167
TaaI ACNGT 1 cut(s) 203
TaqI TCGA 3 cut(s) 72, 78, 101
TasI AATT 1 cut(s) 181
TatI WGTACW 1 cut(s) 198
TfiI GAWTC 2 cut(s) 5, 98
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
XhoI CTCGAG 1 cut(s) 71
XmiI GTMKAC 1 cut(s) 78
XmnI GAANNNNTTC 1 cut(s) 240
XspI CTAG 1 cut(s) 138
ZrmI AGTACT 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.