Rh7CG246700

splicing factor 3B subunit 2

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
23145189 .. 23159556
14368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG246700.1

Sequence Viewer

Length: 270 bp
ATGGCCTTATTCAAGAAGGCTCAGGTGTGGGATGCAACTGCAACTGATCCTAAATTGCTGGTCTTTTTGAAATCGTACAAGAATTTCTTACACATTGAATCTGGAATTTTGGACTTTGCAGACCACTTAAGTCCCACAAATATGGGACTACTCAAGATCCTGGTATCTCTAGTGGCAATGGAAATGAGAAAACTGATGGTATCAGAAACCAAGGATTTTGTTAGGATAGTGCATTGCTTGGATTCTTCAGAGGAGTTTGGGAGTCTCTGA

Protein Analysis

89

Amino Acids

10.07

Weight (kDa)

6.26

Isoelectric Point (pI)

30.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 41, 151
AcsI RAATTY 2 cut(s) 82, 105
AcuI CTGAAG 1 cut(s) 231
AfaI GTAC 1 cut(s) 77
AflII CTTAAG 1 cut(s) 127
AgsI TTSAA 3 cut(s) 13, 70, 98
AjnI CCWGG 1 cut(s) 159
AlwI GGATC 2 cut(s) 41, 151
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 82, 105
BccI CCATC 1 cut(s) 190
BciT130I CCWGG 1 cut(s) 161
BfaI CTAG 1 cut(s) 170
BfrI CTTAAG 1 cut(s) 127
Bme1390I CCNGG 1 cut(s) 161
BmrFI CCNGG 1 cut(s) 161
BmsI GCATC 1 cut(s) 22
Bpu10I CCTNAGC 1 cut(s) 21
BpuEI CTTGAG 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 210
Bse3DI GCAATG 2 cut(s) 183, 232
BseBI CCWGG 1 cut(s) 161
BseDI CCNNGG 1 cut(s) 210
BseGI GGATG 1 cut(s) 37
BseMI GCAATG 2 cut(s) 183, 232
BseMII CTCAG 1 cut(s) 35
BseRI GAGGAG 1 cut(s) 266
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 2 cut(s) 117, 159
BsmFI GGGAC 2 cut(s) 117, 159
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 46, 156
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 34
BspPI GGATC 2 cut(s) 41, 151
BspTI CTTAAG 1 cut(s) 127
BsrDI GCAATG 2 cut(s) 183, 232
BssECI CCNNGG 1 cut(s) 210
BssMI GATC 2 cut(s) 46, 156
BssT1I CCWWGG 1 cut(s) 210
Bst2UI CCWGG 1 cut(s) 161
BstAFI CTTAAG 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 2 cut(s) 49, 159
BstMBI GATC 2 cut(s) 46, 156
BstNI CCWGG 1 cut(s) 161
BstSCI CCNGG 1 cut(s) 159
BstX2I RGATCY 1 cut(s) 156
BstXI CCANNNNNNTGG 1 cut(s) 142
BstYI RGATCY 1 cut(s) 156
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 37
Csp6I GTAC 1 cut(s) 76
CviJI RGCY 2 cut(s) 5, 20
CviKI_1 RGCY 2 cut(s) 5, 20
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 1 cut(s) 21
DpnI GATC 2 cut(s) 48, 158
DpnII GATC 2 cut(s) 46, 156
Eco130I CCWWGG 1 cut(s) 210
Eco57I CTGAAG 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 159
EcoT14I CCWWGG 1 cut(s) 210
ErhI CCWWGG 1 cut(s) 210
FaiI YATR 1 cut(s) 143
FalI AAGNNNNNCTT 2 cut(s) 71, 103
FaqI GGGAC 2 cut(s) 117, 159
FokI GGATG 1 cut(s) 44
FspBI CTAG 1 cut(s) 170
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 3 cut(s) 98, 242, 262
Hpy188I TCNGA 3 cut(s) 205, 250, 269
Hpy188III TCNNGA 3 cut(s) 13, 102, 154
HpyAV CCTTC 1 cut(s) 10
HpyCH4V TGCA 4 cut(s) 35, 41, 119, 232
HpyF3I CTNAG 1 cut(s) 21
Kzo9I GATC 2 cut(s) 46, 156
LpnPI CCDG 5 cut(s) 8, 44, 87, 146, 173
LweI GCATC 1 cut(s) 22
MaeI CTAG 1 cut(s) 170
MalI GATC 2 cut(s) 48, 158
MboI GATC 2 cut(s) 46, 156
MboII GAAGA 1 cut(s) 237
MflI RGATCY 1 cut(s) 156
MluCI AATT 3 cut(s) 53, 82, 105
MnlI CCTC 1 cut(s) 244
MseI TTAA 1 cut(s) 128
MslI CAYNNNNRTG 1 cut(s) 140
MspCI CTTAAG 1 cut(s) 127
MspR9I CCNGG 1 cut(s) 161
MvaI CCWGG 1 cut(s) 161
NdeII GATC 2 cut(s) 46, 156
PfeI GAWTC 2 cut(s) 98, 242
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
PsuI RGATCY 1 cut(s) 156
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
RseI CAYNNNNRTG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 2 cut(s) 46, 156
ScrFI CCNGG 1 cut(s) 161
SetI ASST 1 cut(s) 27
SfaNI GCATC 1 cut(s) 22
SmiMI CAYNNNNRTG 1 cut(s) 140
SmlI CTYRAG 2 cut(s) 127, 152
SmoI CTYRAG 2 cut(s) 127, 152
Sse9I AATT 3 cut(s) 53, 82, 105
SspMI CTAG 1 cut(s) 170
StyD4I CCNGG 1 cut(s) 159
StyI CCWWGG 1 cut(s) 210
TasI AATT 3 cut(s) 53, 82, 105
TfiI GAWTC 2 cut(s) 98, 242
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
Vha464I CTTAAG 1 cut(s) 127
XapI RAATTY 2 cut(s) 82, 105
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.