Rh2CG297600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
34327139 .. 34346473
19335 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG297600.1

Sequence Viewer

Length: 159 bp
ATGTTCAACAGATACTTAAACAAGCGCATTTCTTATACACTTTCCGAAAACTGTTCCTCCTTAAGTCCTAGCAAAATCCTGGAAGGTGTTGATATTCAACTTGGAATGGCAATTGATAGTATAAAAGAAGTAACTCTCATGACTTACACTCCCACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.87

Weight (kDa)

6.04

Isoelectric Point (pI)

36.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 61
AgsI TTSAA 2 cut(s) 7, 98
AjnI CCWGG 1 cut(s) 78
AspLEI GCGC 1 cut(s) 27
BciT130I CCWGG 1 cut(s) 80
BfaI CTAG 1 cut(s) 69
BfrI CTTAAG 1 cut(s) 61
Bme1390I CCNGG 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 80
BsaXI ACNNNNNCTCC 3 cut(s) 41, 71, 133
BseBI CCWGG 1 cut(s) 80
BspHI TCATGA 1 cut(s) 138
BspTI CTTAAG 1 cut(s) 61
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 53
BstAFI CTTAAG 1 cut(s) 61
BstHHI GCGC 1 cut(s) 27
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 78
CciI TCATGA 1 cut(s) 138
CfoI GCGC 1 cut(s) 27
CviAII CATG 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 78
FaeI CATG 1 cut(s) 142
FaiI YATR 3 cut(s) 36, 122, 140
FatI CATG 1 cut(s) 138
FspBI CTAG 1 cut(s) 69
FspEI CC 9 cut(s) 58, 65, 69, 70, 73, 81, 87, 92, 92
GlaI GCGC 1 cut(s) 26
HhaI GCGC 1 cut(s) 27
Hin1II CATG 1 cut(s) 142
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 77
HpyCH4III ACNGT 1 cut(s) 53
Hsp92II CATG 1 cut(s) 142
HspAI GCGC 1 cut(s) 25
LpnPI CCDG 2 cut(s) 65, 92
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 130
MfeI CAATTG 1 cut(s) 111
MluCI AATT 1 cut(s) 111
MnlI CCTC 1 cut(s) 67
MseI TTAA 2 cut(s) 17, 62
MspCI CTTAAG 1 cut(s) 61
MspR9I CCNGG 1 cut(s) 80
MunI CAATTG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 80
NlaIII CATG 1 cut(s) 142
PagI TCATGA 1 cut(s) 138
PfoI TCCNGGA 1 cut(s) 78
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
SaqAI TTAA 2 cut(s) 17, 62
ScrFI CCNGG 1 cut(s) 80
SetI ASST 1 cut(s) 88
SgeI CNNG 6 cut(s) 34, 81, 91, 92, 113, 151
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 1 cut(s) 111
SspMI CTAG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 53
TasI AATT 1 cut(s) 111
Tru1I TTAA 2 cut(s) 17, 62
Tru9I TTAA 2 cut(s) 17, 62
Vha464I CTTAAG 1 cut(s) 61
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.