Rmu_co8114566.1_g000001

serine carboxypeptidase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8114566.1
OG0000839
Physical Location & Seq
Forward (+)
1 .. 563
563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8114566.1_g000001.1.cds

Sequence Viewer

Length: 315 bp
gggaaccagggcacgaaaaggctttggcaacactgtaatacgacattggactacactgaagatgtcaccagcgtaatcatttatcaccaaagtctttcaaaaatggctgatctacgtgttctgatatacaatggtgatcatgacatgcaagttcctcatattggtacacaaagatggataagcacactgaatttgactgaggatgaatcctggaggacatggtcagttgatggccaaactgcaggatacacgaagaagttgatcaatgaatatatcactttgacatatgcgactgtaaaggcaagtataatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S10

Protein Analysis

104

Amino Acids

11.96

Weight (kDa)

6.04

Isoelectric Point (pI)

34.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 232
AcsI RAATTY 1 cut(s) 190
AcuI CTGAAG 1 cut(s) 78
AfaI GTAC 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 161
AflIII ACRYGT 1 cut(s) 115
AgsI TTSAA 1 cut(s) 99
AjnI CCWGG 2 cut(s) 6, 209
AoxI GGCC 1 cut(s) 232
ApoI RAATTY 1 cut(s) 190
AsuHPI GGTGA 3 cut(s) 58, 77, 146
BaeGI GKGCMC 1 cut(s) 14
BalI TGGCCA 1 cut(s) 234
BccI CCATC 2 cut(s) 168, 224
BciT130I CCWGG 2 cut(s) 8, 211
BciVI GTATCC 1 cut(s) 239
BclI TGATCA 2 cut(s) 136, 261
BfmI CTRYAG 1 cut(s) 240
BfuI GTATCC 1 cut(s) 239
Bme1390I CCNGG 2 cut(s) 8, 211
BmiI GGNNCC 1 cut(s) 5
BmrFI CCNGG 2 cut(s) 8, 211
BpmI CTGGAG 1 cut(s) 232
BsaAI YACGTR 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 7
Bsc4I CCNNNNNNNGG 1 cut(s) 161
BseBI CCWGG 2 cut(s) 8, 211
BseDI CCNNGG 1 cut(s) 7
BseGI GGATG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 161
BseMII CTCAG 1 cut(s) 189
BseSI GKGCMC 1 cut(s) 14
BshFI GGCC 1 cut(s) 234
BslI CCNNNNNNNGG 1 cut(s) 161
BsnI GGCC 1 cut(s) 234
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 3 cut(s) 109, 136, 261
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 190
BspHI TCATGA 1 cut(s) 139
BspLI GGNNCC 1 cut(s) 5
BspMAI CTGCAG 1 cut(s) 244
BssECI CCNNGG 1 cut(s) 7
BssMI GATC 3 cut(s) 109, 136, 261
Bst2UI CCWGG 2 cut(s) 8, 211
Bst4CI ACNGT 2 cut(s) 35, 295
BstBAI YACGTR 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 198
BstF5I GGATG 1 cut(s) 208
BstKTI GATC 3 cut(s) 112, 139, 264
BstMBI GATC 3 cut(s) 109, 136, 261
BstNI CCWGG 2 cut(s) 8, 211
BstNSI RCATGY 1 cut(s) 148
BstSCI CCNGG 2 cut(s) 6, 209
BstSFI CTRYAG 1 cut(s) 240
BstSLI GKGCMC 1 cut(s) 14
BsuI GTATCC 1 cut(s) 239
BsuRI GGCC 1 cut(s) 234
BtsCI GGATG 1 cut(s) 208
BtsIMutI CAGTG 3 cut(s) 31, 54, 185
CciI TCATGA 1 cut(s) 139
Csp6I GTAC 1 cut(s) 165
CviAII CATG 3 cut(s) 140, 145, 219
CviJI RGCY 3 cut(s) 22, 107, 234
CviKI_1 RGCY 3 cut(s) 22, 107, 234
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 1 cut(s) 198
DpnI GATC 3 cut(s) 111, 138, 263
DpnII GATC 3 cut(s) 109, 136, 261
EaeI YGGCCR 1 cut(s) 232
Eco57I CTGAAG 1 cut(s) 78
EcoRII CCWGG 2 cut(s) 6, 209
FaeI CATG 3 cut(s) 143, 148, 222
FaiI YATR 9 cut(s) 127, 141, 146, 159, 220, 273, 286, 288, 308
FatI CATG 3 cut(s) 139, 144, 218
FauNDI CATATG 1 cut(s) 286
FbaI TGATCA 2 cut(s) 136, 261
FokI GGATG 1 cut(s) 215
GsuI CTGGAG 1 cut(s) 232
HaeIII GGCC 1 cut(s) 234
Hin1II CATG 3 cut(s) 143, 148, 222
HinfI GANTC 1 cut(s) 206
HphI GGTGA 3 cut(s) 58, 77, 146
Hpy166II GTNNAC 1 cut(s) 167
Hpy188I TCNGA 2 cut(s) 123, 314
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 1 cut(s) 167
HpyCH4III ACNGT 2 cut(s) 35, 295
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 148, 242
HpyF3I CTNAG 1 cut(s) 198
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 3 cut(s) 143, 148, 222
Ksp22I TGATCA 2 cut(s) 136, 261
Kzo9I GATC 3 cut(s) 109, 136, 261
LpnPI CCDG 5 cut(s) 20, 82, 196, 223, 228
MaeII ACGT 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 64
MalI GATC 3 cut(s) 111, 138, 263
MboI GATC 3 cut(s) 109, 136, 261
MboII GAAGA 2 cut(s) 71, 265
MhlI GDGCHC 1 cut(s) 14
MlsI TGGCCA 1 cut(s) 234
MluCI AATT 1 cut(s) 190
MluNI TGGCCA 1 cut(s) 234
MnlI CCTC 3 cut(s) 165, 193, 207
Mox20I TGGCCA 1 cut(s) 234
MscI TGGCCA 1 cut(s) 234
MslI CAYNNNNRTG 1 cut(s) 172
Msp20I TGGCCA 1 cut(s) 234
MspR9I CCNGG 2 cut(s) 8, 211
MvaI CCWGG 2 cut(s) 8, 211
NdeI CATATG 1 cut(s) 286
NdeII GATC 3 cut(s) 109, 136, 261
NlaIII CATG 3 cut(s) 143, 148, 222
NlaIV GGNNCC 1 cut(s) 5
NmuCI GTSAC 1 cut(s) 64
NspI RCATGY 1 cut(s) 148
PagI TCATGA 1 cut(s) 139
PfeI GAWTC 1 cut(s) 206
PflFI GACNNNGTC 1 cut(s) 220
PfoI TCCNGGA 1 cut(s) 209
Ppu21I YACGTR 1 cut(s) 116
Psp6I CCWGG 2 cut(s) 6, 209
PspGI CCWGG 2 cut(s) 6, 209
PspN4I GGNNCC 1 cut(s) 5
PstI CTGCAG 1 cut(s) 244
PsyI GACNNNGTC 1 cut(s) 220
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
RseI CAYNNNNRTG 1 cut(s) 172
Sau3AI GATC 3 cut(s) 109, 136, 261
ScrFI CCNGG 2 cut(s) 8, 211
SduI GDGCHC 1 cut(s) 14
SetI ASST 1 cut(s) 118
SfcI CTRYAG 1 cut(s) 240
SmiMI CAYNNNNRTG 1 cut(s) 172
Sse9I AATT 1 cut(s) 190
StyD4I CCNGG 2 cut(s) 6, 209
TaaI ACNGT 2 cut(s) 35, 295
TaiI ACGT 1 cut(s) 118
TasI AATT 1 cut(s) 190
TfiI GAWTC 1 cut(s) 206
TscAI CASTG 3 cut(s) 38, 61, 192
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 219, 282
TspRI CASTG 3 cut(s) 38, 61, 192
Tth111I GACNNNGTC 1 cut(s) 220
XapI RAATTY 1 cut(s) 190
XceI RCATGY 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.