Rmu_sc0004835.1_g000032

serine carboxypeptidase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004835.1
OG0000839
Physical Location & Seq
Reverse (-)
121507 .. 125271
3765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004835.1_g000032.1.cds

Sequence Viewer

Length: 1359 bp
atgttcgctttcactttgatactcacttcaacttcagctgccagcattactacaaccaacattacgattctaccgggttattccggtgaccttccttttgcactggaatccggatatatcggtgttggtgacaatgaagaagtgcagctattttatgttttcgttgagtctgagagagctcctgcagacgatcctctgttgctatggttcaatggaggcccaggttgctctggtcttgctggattcttctttgagagtggtccagtaacttttaagtttggaaattacaatgggagcctaccagcagttcttgacaatccatttcgatggacaaaggacgtcagcatgatatacatagatgcacctgttggtgctggattctcctactcaaaaactcaaagtggttatgttatgaatgactataaatatgttgcacaaagctatgaatttctgcagaagtggctggaggcacaccctgcatatttggaaaatgtactctacattggtggtgactccttctctggcattattgtgcctatgattgttcaacaaatattggatggtaatgaaaatgaaactttgcctctaatgaatctcaagggatatgtaattgggaacccagtaacggattcattcattgatgcaaatgcaagaattccttatgcccatcggctaactcttatatcagatcaactgtatcgggcggcgaaaacaagttgcagtggagattacgtaaacgtagattcaagcaatgacgcatgcatttcagatatcgatgctattgatgcactcataaatgacataaataccttacacgtcttggaaccagtgtgtagtgaaggcactgcccgaagatatctcaaagatttgtccgaaggtttactaagttcagcaactactggtcctgcatattggtgtaggagttataatcatatgctcgcctacaattgggcaaaccaccaaagtgttcaagatgctcttggcgtccgaaggggcacaaaaagattttggcaatactgtaattcaaccctggcgtacactcaagaagtcactagtgttattagtcttcatcaaagtttcacggaggttggcctacgtgctctgatctacagtggtgatcacgacatgacaattcctcaccttgctacacaaaaatggataaactttctcaatatgactctgaatgagacctggagggcatggtcagttgataaccaaactgcagggtacacaaagaagtttgtaaatgaagctttcaatttgacgtttgcaactggaggaggccacattgctgcagagtacaaggtcaaagaatgctctgcaatgattgatagatggatggctcagtaccctctctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S10

Protein Analysis

452

Amino Acids

50.22

Weight (kDa)

4.83

Isoelectric Point (pI)

34.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 927
AatII GACGTC 1 cut(s) 342
AccIII TCCGGA 1 cut(s) 110
AciI CCGC 1 cut(s) 704
AclWI GGATC 1 cut(s) 185
AcsI RAATTY 2 cut(s) 446, 654
AcuI CTGAAG 1 cut(s) 18
AcyI GRCGYC 2 cut(s) 339, 984
AfaI GTAC 5 cut(s) 495, 1037, 1229, 1301, 1349
AfiI CCNNNNNNNGG 2 cut(s) 625, 948
AflIII ACRYGT 1 cut(s) 814
AgsI TTSAA 7 cut(s) 30, 211, 548, 747, 971, 1026, 1258
AhlI ACTAGT 1 cut(s) 1052
AjiI CACGTC 1 cut(s) 817
AjnI CCWGG 3 cut(s) 220, 1029, 1190
AleI CACNNNNGTG 1 cut(s) 963
AluBI AGCT 5 cut(s) 38, 148, 179, 441, 1253
AluI AGCT 5 cut(s) 38, 148, 179, 441, 1253
Alw21I GWGCWC 2 cut(s) 181, 1102
Alw26I GTCTC 1 cut(s) 1181
AlwI GGATC 1 cut(s) 185
Aor13HI TCCGGA 1 cut(s) 110
AoxI GGCC 3 cut(s) 217, 1090, 1282
ApeKI GCWGC 3 cut(s) 38, 145, 1292
ApoI RAATTY 2 cut(s) 446, 654
ArsI GACNNNNNNTTYG 2 cut(s) 80, 112
AspS9I GGNCC 3 cut(s) 218, 260, 902
AsuC2I CCSGG 1 cut(s) 75
AsuHPI GGTGA 5 cut(s) 98, 140, 521, 1127, 1130
AvaII GGWCC 2 cut(s) 260, 902
BaeGI GKGCMC 1 cut(s) 998
BanII GRGCYC 1 cut(s) 181
BbsI GAAGAC 1 cut(s) 1058
Bbv12I GWGCWC 2 cut(s) 181, 1102
BbvI GCAGC 3 cut(s) 25, 157, 1279
BccI CCATC 5 cut(s) 321, 554, 675, 1329, 1333
BciT130I CCWGG 3 cut(s) 222, 1031, 1192
BclI TGATCA 1 cut(s) 1117
BcnI CCSGG 1 cut(s) 75
BcoDI GTCTC 1 cut(s) 1181
BcuI ACTAGT 1 cut(s) 1052
BfaI CTAG 1 cut(s) 1053
BfmI CTRYAG 5 cut(s) 183, 452, 1108, 1221, 1293
BisI GCNGC 4 cut(s) 39, 146, 705, 1293
BlsI GCNGC 4 cut(s) 40, 147, 706, 1294
Bme1390I CCNGG 4 cut(s) 75, 222, 1031, 1192
Bme18I GGWCC 2 cut(s) 260, 902
BmgBI CACGTC 1 cut(s) 817
BmgT120I GGNCC 3 cut(s) 218, 260, 902
BmiI GGNNCC 3 cut(s) 296, 617, 825
BmrFI CCNGG 4 cut(s) 75, 222, 1031, 1192
BmrI ACTGGG 1 cut(s) 614
BmsI GCATC 5 cut(s) 349, 631, 766, 775, 964
BmuI ACTGGG 1 cut(s) 614
BpiI GAAGAC 1 cut(s) 1058
BpmI CTGGAG 3 cut(s) 485, 1213, 1296
BpuEI CTTGAG 2 cut(s) 581, 1026
BpuMI CCSGG 1 cut(s) 75
Bsa29I ATCGAT 1 cut(s) 774
BsaAI YACGTR 2 cut(s) 733, 1097
BsaHI GRCGYC 2 cut(s) 339, 984
BsaI GGTCTC 1 cut(s) 1181
BsaJI CCNNGG 2 cut(s) 220, 1029
BsaWI WCCGGW 2 cut(s) 83, 110
BsaXI ACNNNNNCTCC 2 cut(s) 717, 747
Bsc4I CCNNNNNNNGG 2 cut(s) 625, 948
Bse1I ACTGG 6 cut(s) 108, 263, 620, 827, 904, 1279
Bse3DI GCAATG 3 cut(s) 757, 1287, 1329
BseAI TCCGGA 1 cut(s) 110
BseBI CCWGG 3 cut(s) 222, 1031, 1192
BseCI ATCGAT 1 cut(s) 774
BseDI CCNNGG 2 cut(s) 220, 1029
BseGI GGATG 2 cut(s) 565, 1344
BseLI CCNNNNNNNGG 2 cut(s) 625, 948
BseMI GCAATG 3 cut(s) 757, 1287, 1329
BseMII CTCAG 2 cut(s) 162, 1358
BseNI ACTGG 6 cut(s) 108, 263, 620, 827, 904, 1279
BseRI GAGGAG 1 cut(s) 1293
BseSI GKGCMC 1 cut(s) 998
BseXI GCAGC 3 cut(s) 25, 157, 1279
BsgI GTGCAG 1 cut(s) 164
BshFI GGCC 3 cut(s) 219, 1092, 1284
BshVI ATCGAT 1 cut(s) 774
BsiHKAI GWGCWC 2 cut(s) 181, 1102
BsiSI CCGG 3 cut(s) 74, 84, 111
BslI CCNNNNNNNGG 2 cut(s) 625, 948
BsmAI GTCTC 1 cut(s) 1181
BsmI GAATGC 1 cut(s) 1319
BsnI GGCC 3 cut(s) 219, 1092, 1284
Bso31I GGTCTC 1 cut(s) 1181
Bsp1286I GDGCHC 3 cut(s) 181, 998, 1102
Bsp13I TCCGGA 1 cut(s) 110
Bsp143I GATC 4 cut(s) 190, 688, 1104, 1117
BspACI CCGC 1 cut(s) 704
BspANI GGCC 3 cut(s) 219, 1092, 1284
BspCNI CTCAG 2 cut(s) 163, 1357
BspDI ATCGAT 1 cut(s) 774
BspEI TCCGGA 1 cut(s) 110
BspLI GGNNCC 3 cut(s) 296, 617, 825
BspMAI CTGCAG 4 cut(s) 187, 456, 1225, 1297
BspPI GGATC 1 cut(s) 185
BspTNI GGTCTC 1 cut(s) 1181
BsrDI GCAATG 3 cut(s) 757, 1287, 1329
BsrI ACTGG 6 cut(s) 108, 263, 620, 827, 904, 1279
BssECI CCNNGG 2 cut(s) 220, 1029
BssMI GATC 4 cut(s) 190, 688, 1104, 1117
BssNI GRCGYC 2 cut(s) 339, 984
Bst2UI CCWGG 3 cut(s) 222, 1031, 1192
Bst4CI ACNGT 3 cut(s) 696, 1019, 1112
BstACI GRCGYC 2 cut(s) 339, 984
BstAPI GCANNNNNTGC 1 cut(s) 476
BstBAI YACGTR 2 cut(s) 733, 1097
BstC8I GCNNGC 3 cut(s) 43, 760, 939
BstDEI CTNAG 3 cut(s) 171, 884, 1344
BstEII GGTNACC 1 cut(s) 86
BstF5I GGATG 2 cut(s) 565, 1344
BstKTI GATC 4 cut(s) 193, 691, 1107, 1120
BstMAI GTCTC 1 cut(s) 1181
BstMBI GATC 4 cut(s) 190, 688, 1104, 1117
BstMWI GCNNNNNNNGC 4 cut(s) 225, 460, 476, 785
BstNI CCWGG 3 cut(s) 222, 1031, 1192
BstNSI RCATGY 1 cut(s) 762
BstPI GGTNACC 1 cut(s) 86
BstSCI CCNGG 4 cut(s) 73, 220, 1029, 1190
BstSFI CTRYAG 5 cut(s) 183, 452, 1108, 1221, 1293
BstSLI GKGCMC 1 cut(s) 998
BstSNI TACGTA 1 cut(s) 733
BstV1I GCAGC 3 cut(s) 25, 157, 1279
BstV2I GAAGAC 1 cut(s) 1058
BstXI CCANNNNNNTGG 1 cut(s) 327
Bsu15I ATCGAT 1 cut(s) 774
BsuRI GGCC 3 cut(s) 219, 1092, 1284
BsuTUI ATCGAT 1 cut(s) 774
BtrI CACGTC 1 cut(s) 817
BtsCI GGATG 2 cut(s) 565, 1344
BtsI GCAGTG 2 cut(s) 727, 843
BtsIMutI CAGTG 5 cut(s) 101, 727, 834, 843, 1117
Cac8I GCNNGC 3 cut(s) 43, 760, 939
Cfr13I GGNCC 3 cut(s) 218, 260, 902
ClaI ATCGAT 1 cut(s) 774
CseI GACGC 2 cut(s) 764, 973
Csp6I GTAC 5 cut(s) 494, 1036, 1228, 1300, 1348
CviAII CATG 4 cut(s) 346, 759, 1126, 1200
CviQI GTAC 5 cut(s) 494, 1036, 1228, 1300, 1348
DdeI CTNAG 3 cut(s) 171, 884, 1344
DpnI GATC 4 cut(s) 192, 690, 1106, 1119
DpnII GATC 4 cut(s) 190, 688, 1104, 1117
Ecl136II GAGCTC 1 cut(s) 179
Eco105I TACGTA 1 cut(s) 733
Eco24I GRGCYC 1 cut(s) 181
Eco31I GGTCTC 1 cut(s) 1181
Eco32I GATATC 2 cut(s) 772, 857
Eco47I GGWCC 2 cut(s) 260, 902
Eco53kI GAGCTC 1 cut(s) 179
Eco57I CTGAAG 1 cut(s) 18
Eco91I GGTNACC 1 cut(s) 86
EcoICRI GAGCTC 1 cut(s) 179
EcoO65I GGTNACC 1 cut(s) 86
EcoRI GAATTC 1 cut(s) 654
EcoRII CCWGG 3 cut(s) 220, 1029, 1190
EcoRV GATATC 2 cut(s) 772, 857
EcoT22I ATGCAT 1 cut(s) 764
EcoT38I GRGCYC 1 cut(s) 181
FaeI CATG 4 cut(s) 349, 762, 1129, 1203
FalI AAGNNNNNCTT 4 cut(s) 643, 675, 963, 995
FatI CATG 4 cut(s) 345, 758, 1125, 1199
FauNDI CATATG 1 cut(s) 933
FbaI TGATCA 1 cut(s) 1117
Fnu4HI GCNGC 4 cut(s) 39, 146, 705, 1293
FokI GGATG 2 cut(s) 572, 1351
FriOI GRGCYC 1 cut(s) 181
Fsp4HI GCNGC 4 cut(s) 39, 146, 705, 1293
FspBI CTAG 1 cut(s) 1053
GluI GCNGC 4 cut(s) 39, 146, 705, 1293
GsuI CTGGAG 3 cut(s) 485, 1213, 1296
HaeIII GGCC 3 cut(s) 219, 1092, 1284
HapII CCGG 3 cut(s) 74, 84, 111
HgaI GACGC 2 cut(s) 764, 973
Hin1I GRCGYC 2 cut(s) 339, 984
Hin1II CATG 4 cut(s) 349, 762, 1129, 1203
HindIII AAGCTT 1 cut(s) 1251
HpaII CCGG 3 cut(s) 74, 84, 111
HphI GGTGA 5 cut(s) 98, 140, 521, 1127, 1130
Hpy166II GTNNAC 4 cut(s) 736, 881, 1038, 1230
Hpy188I TCNGA 7 cut(s) 172, 688, 769, 874, 989, 1104, 1182
Hpy188III TCNNGA 5 cut(s) 111, 311, 971, 1043, 1121
Hpy8I GTNNAC 4 cut(s) 736, 881, 1038, 1230
HpyAV CCTTC 5 cut(s) 101, 526, 833, 869, 984
HpyCH4III ACNGT 3 cut(s) 696, 1019, 1112
HpyCH4IV ACGT 6 cut(s) 339, 732, 738, 816, 1096, 1265
HpyF10VI GCNNNNNNNGC 4 cut(s) 225, 460, 476, 785
HpyF3I CTNAG 3 cut(s) 171, 884, 1344
HpySE526I ACGT 6 cut(s) 339, 732, 738, 816, 1096, 1265
Hsp92I GRCGYC 2 cut(s) 339, 984
Hsp92II CATG 4 cut(s) 349, 762, 1129, 1203
Kpn2I TCCGGA 1 cut(s) 110
Ksp22I TGATCA 1 cut(s) 1117
Kzo9I GATC 4 cut(s) 190, 688, 1104, 1117
LmnI GCTCC 2 cut(s) 184, 294
Lsp1109I GCAGC 3 cut(s) 25, 157, 1279
LweI GCATC 5 cut(s) 349, 631, 766, 775, 964
MaeI CTAG 1 cut(s) 1053
MaeII ACGT 6 cut(s) 339, 732, 738, 816, 1096, 1265
MaeIII GTNAC 6 cut(s) 86, 128, 265, 509, 622, 1048
MalI GATC 4 cut(s) 192, 690, 1106, 1119
MboI GATC 4 cut(s) 190, 688, 1104, 1117
MboII GAAGA 4 cut(s) 149, 238, 864, 1058
MfeI CAATTG 1 cut(s) 946
MhlI GDGCHC 3 cut(s) 181, 998, 1102
MluCI AATT 8 cut(s) 283, 446, 609, 654, 946, 1021, 1131, 1258
MlyI GAGTC 3 cut(s) 176, 506, 1171
MnlI CCTC 9 cut(s) 204, 209, 460, 594, 1078, 1146, 1188, 1271, 1274
Mph1103I ATGCAT 1 cut(s) 764
MroI TCCGGA 1 cut(s) 110
MseI TTAA 1 cut(s) 273
MslI CAYNNNNRTG 5 cut(s) 325, 530, 913, 963, 1153
MspA1I CMGCKG 1 cut(s) 38
MspI CCGG 3 cut(s) 74, 84, 111
MspR9I CCNGG 4 cut(s) 75, 222, 1031, 1192
MunI CAATTG 1 cut(s) 946
Mva1269I GAATGC 1 cut(s) 1319
MvaI CCWGG 3 cut(s) 222, 1031, 1192
MwoI GCNNNNNNNGC 4 cut(s) 225, 460, 476, 785
NciI CCSGG 1 cut(s) 75
NdeI CATATG 1 cut(s) 933
NdeII GATC 4 cut(s) 190, 688, 1104, 1117
NlaIII CATG 4 cut(s) 349, 762, 1129, 1203
NlaIV GGNNCC 3 cut(s) 296, 617, 825
NmuCI GTSAC 4 cut(s) 86, 128, 509, 1048
NsiI ATGCAT 1 cut(s) 764
NspI RCATGY 1 cut(s) 762
OliI CACNNNNGTG 1 cut(s) 963
PaeI GCATGC 1 cut(s) 762
PctI GAATGC 1 cut(s) 1319
PfeI GAWTC 7 cut(s) 67, 107, 243, 378, 592, 629, 743
PkrI GCNGC 4 cut(s) 40, 147, 706, 1294
PleI GAGTC 3 cut(s) 175, 506, 1171
PpsI GAGTC 3 cut(s) 175, 506, 1171
Ppu21I YACGTR 2 cut(s) 733, 1097
PsiI TTATAA 1 cut(s) 927
Psp124BI GAGCTC 1 cut(s) 181
Psp6I CCWGG 3 cut(s) 220, 1029, 1190
PspEI GGTNACC 1 cut(s) 86
PspGI CCWGG 3 cut(s) 220, 1029, 1190
PspN4I GGNNCC 3 cut(s) 296, 617, 825
PspPI GGNCC 3 cut(s) 218, 260, 902
PstI CTGCAG 4 cut(s) 187, 456, 1225, 1297
PvuII CAGCTG 1 cut(s) 38
RsaI GTAC 5 cut(s) 495, 1037, 1229, 1301, 1349
RsaNI GTAC 5 cut(s) 494, 1036, 1228, 1300, 1348
RseI CAYNNNNRTG 5 cut(s) 325, 530, 913, 963, 1153
SacI GAGCTC 1 cut(s) 181
SaqAI TTAA 1 cut(s) 273
SatI GCNGC 4 cut(s) 39, 146, 705, 1293
Sau3AI GATC 4 cut(s) 190, 688, 1104, 1117
Sau96I GGNCC 3 cut(s) 218, 260, 902
SchI GAGTC 3 cut(s) 176, 506, 1171
ScrFI CCNGG 4 cut(s) 75, 222, 1031, 1192
SduI GDGCHC 3 cut(s) 181, 998, 1102
SfaNI GCATC 5 cut(s) 349, 631, 766, 775, 964
SfcI CTRYAG 5 cut(s) 183, 452, 1108, 1221, 1293
SinI GGWCC 2 cut(s) 260, 902
SmiMI CAYNNNNRTG 5 cut(s) 325, 530, 913, 963, 1153
SmlI CTYRAG 2 cut(s) 596, 1041
SmoI CTYRAG 2 cut(s) 596, 1041
SnaBI TACGTA 1 cut(s) 733
SpeI ACTAGT 1 cut(s) 1052
SphI GCATGC 1 cut(s) 762
Sse9I AATT 8 cut(s) 283, 446, 609, 654, 946, 1021, 1131, 1258
SsiI CCGC 1 cut(s) 704
SspI AATATT 1 cut(s) 555
SspMI CTAG 1 cut(s) 1053
SstI GAGCTC 1 cut(s) 181
StyD4I CCNGG 4 cut(s) 73, 220, 1029, 1190
TaaI ACNGT 3 cut(s) 696, 1019, 1112
TaiI ACGT 6 cut(s) 342, 735, 741, 819, 1099, 1268
TaqI TCGA 2 cut(s) 325, 774
TasI AATT 8 cut(s) 283, 446, 609, 654, 946, 1021, 1131, 1258
TatI WGTACW 2 cut(s) 493, 1299
TauI GCSGC 1 cut(s) 707
TfiI GAWTC 7 cut(s) 67, 107, 243, 378, 592, 629, 743
Tru1I TTAA 1 cut(s) 273
Tru9I TTAA 1 cut(s) 273
TscAI CASTG 5 cut(s) 108, 727, 834, 850, 1117
TseFI GTSAC 4 cut(s) 86, 128, 509, 1048
TseI GCWGC 3 cut(s) 38, 145, 1292
Tsp45I GTSAC 4 cut(s) 86, 128, 509, 1048
TspGWI ACGGA 2 cut(s) 641, 1097
TspRI CASTG 5 cut(s) 108, 727, 834, 850, 1117
VpaK11BI GGWCC 2 cut(s) 260, 902
XapI RAATTY 2 cut(s) 446, 654
XceI RCATGY 1 cut(s) 762
XspI CTAG 1 cut(s) 1053
ZraI GACGTC 1 cut(s) 340
Zsp2I ATGCAT 1 cut(s) 764
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.