Rmu_sc0004835.1_g000012

serine carboxypeptidase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004835.1
Physical Location & Seq
Forward (+)
40778 .. 46156
5379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004835.1_g000012.1.cds

Sequence Viewer

Length: 1254 bp
atgttggcttttacgtctttcaccctgacatttagtgcttcagcttcaaactggaccatcatcaaaactctaccaggttattctggtgatcttcctttcgctttagaatctggatatattggtgtaggagacgatgaaaaagtgcagctgttttactattttatcgagtctcagaggaaccctgcacaagatcctctgctgtattggatcactggaggccctggttgctctagtcttgctggatttttctttgagagtggtccattggttttcaactacaaagattacaatggaagcctaccaacacttcaggacaatccttatgcatggacacagggactcaacatcatatacttggatgcaccagttggggccggatactcctactcagaaacccaaagtggttatgttatggatgactataaatttgtggctcacatttatgaatttctgcaaaagtggctagaggcacacccgacatatttggaaaatctactctatattggtggtgactcttattctggcatacctattcccatgcttgcagaacaaatagttgatggtaatgaaaatggaagtgtgcctatgatgaatctcaaagggtatgtgcttgggaacccagtaactgattctgtcattgatatgaatgcaagagttacttatgctcacaggttgtctcttgtgtcggatcaactgtataagctcaccaatgacataaatttggtacacatcttggaaccatattgtagtaatgcattgcctacagcaaaggagatgtgtcaagctcgtagatacctcaaagacttgtccaaaggtttactaagttcaccacctaacggtcctgcactttggtgtcgaagttataatcacatgctcgcctcggtttgggcaaacaacaaaggtgtccaagatgctcttggtgtccgaaggggcaccaaacagttttggcagtactgtaataccacattggcttacactaaagttgccacaagtgtagtgagttatcatcaaattctctcaaagagggctgaccttcgtgctctgatatacagtggtgaccatgacatgtcaattcctcatattggtacacaagaatggataaagactctgaatttgactgtggacgagtcctggaggacatggtcaattgatggccaaactgcagggtacggtgcaggccactttgcggcagagtataaagtcaaggaatgtgctgccatgattgatcgatggatgggttacttccctctctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

417

Amino Acids

46.7

Weight (kDa)

5.37

Isoelectric Point (pI)

32.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 864
AccB1I GGYRCC 1 cut(s) 932
AciI CCGC 1 cut(s) 1187
AclWI GGATC 3 cut(s) 185, 215, 696
AcoI YGGCCR 1 cut(s) 1153
AcsI RAATTY 5 cut(s) 425, 446, 718, 1011, 1111
AcuI CTGAAG 2 cut(s) 24, 293
AfaI GTAC 4 cut(s) 726, 953, 1087, 1169
AfiI CCNNNNNNNGG 4 cut(s) 836, 885, 1082, 1186
AflIII ACRYGT 1 cut(s) 1065
AgsI TTSAA 2 cut(s) 48, 274
AjnI CCWGG 3 cut(s) 73, 220, 1130
AleI CACNNNNGTG 1 cut(s) 850
AluBI AGCT 4 cut(s) 44, 148, 703, 785
AluI AGCT 4 cut(s) 44, 148, 703, 785
Alw21I GWGCWC 1 cut(s) 1042
Alw26I GTCTC 3 cut(s) 123, 174, 681
AlwI GGATC 3 cut(s) 185, 215, 696
AlwNI CAGNNNCTG 1 cut(s) 626
AoxI GGCC 4 cut(s) 217, 372, 1153, 1177
ApeKI GCWGC 2 cut(s) 145, 1214
ApoI RAATTY 5 cut(s) 425, 446, 718, 1011, 1111
ArsI GACNNNNNNTTYG 4 cut(s) 410, 442, 1096, 1128
AspS9I GGNCC 5 cut(s) 54, 218, 260, 372, 839
AsuHPI GGTGA 6 cut(s) 13, 98, 521, 697, 819, 1067
AvaII GGWCC 3 cut(s) 54, 260, 839
BaeGI GKGCMC 1 cut(s) 935
BalI TGGCCA 1 cut(s) 1155
BanI GGYRCC 1 cut(s) 932
Bbv12I GWGCWC 1 cut(s) 1042
BbvI GCAGC 2 cut(s) 157, 1201
BccI CCATC 5 cut(s) 65, 554, 1145, 1224, 1228
BciT130I CCWGG 3 cut(s) 75, 222, 1132
BciVI GTATCC 1 cut(s) 371
BcoDI GTCTC 3 cut(s) 123, 174, 681
BfaI CTAG 2 cut(s) 231, 464
BfmI CTRYAG 2 cut(s) 762, 1161
BfuI GTATCC 1 cut(s) 371
BisI GCNGC 3 cut(s) 146, 1188, 1215
BlsI GCNGC 3 cut(s) 147, 1189, 1216
BmcAI AGTACT 1 cut(s) 953
Bme1390I CCNGG 3 cut(s) 75, 222, 1132
Bme18I GGWCC 3 cut(s) 54, 260, 839
BmgT120I GGNCC 5 cut(s) 54, 218, 260, 372, 839
BmiI GGNNCC 5 cut(s) 179, 373, 617, 738, 934
BmrFI CCNGG 3 cut(s) 75, 222, 1132
BmrI ACTGGG 1 cut(s) 614
BmsI GCATC 2 cut(s) 349, 901
BmuI ACTGGG 1 cut(s) 614
BpmI CTGGAG 2 cut(s) 234, 1153
Bsa29I ATCGAT 1 cut(s) 1228
BsaJI CCNNGG 2 cut(s) 220, 879
Bsc4I CCNNNNNNNGG 4 cut(s) 836, 885, 1082, 1186
Bse1I ACTGG 4 cut(s) 56, 217, 365, 620
Bse3DI GCAATG 1 cut(s) 755
BseBI CCWGG 3 cut(s) 75, 222, 1132
BseCI ATCGAT 1 cut(s) 1228
BseDI CCNNGG 2 cut(s) 220, 879
BseGI GGATG 3 cut(s) 364, 421, 1239
BseLI CCNNNNNNNGG 4 cut(s) 836, 885, 1082, 1186
BseMI GCAATG 1 cut(s) 755
BseMII CTCAG 2 cut(s) 185, 402
BseNI ACTGG 4 cut(s) 56, 217, 365, 620
BseSI GKGCMC 1 cut(s) 935
BseXI GCAGC 2 cut(s) 157, 1201
BsgI GTGCAG 4 cut(s) 164, 168, 828, 1194
BshFI GGCC 4 cut(s) 219, 374, 1155, 1179
BshNI GGYRCC 1 cut(s) 932
BshVI ATCGAT 1 cut(s) 1228
BsiHKAI GWGCWC 1 cut(s) 1042
BsiSI CCGG 1 cut(s) 375
BslFI GGGAC 1 cut(s) 351
BslI CCNNNNNNNGG 4 cut(s) 836, 885, 1082, 1186
BsmAI GTCTC 3 cut(s) 123, 174, 681
BsmBI CGTCTC 1 cut(s) 123
BsmFI GGGAC 1 cut(s) 351
BsmI GAATGC 1 cut(s) 652
BsnI GGCC 4 cut(s) 219, 374, 1155, 1179
Bsp1286I GDGCHC 2 cut(s) 935, 1042
Bsp143I GATC 5 cut(s) 88, 190, 207, 688, 1225
BspACI CCGC 1 cut(s) 1187
BspANI GGCC 4 cut(s) 219, 374, 1155, 1179
BspCNI CTCAG 2 cut(s) 184, 401
BspDI ATCGAT 1 cut(s) 1228
BspLI GGNNCC 5 cut(s) 179, 373, 617, 738, 934
BspMAI CTGCAG 1 cut(s) 1165
BspPI GGATC 3 cut(s) 185, 215, 696
BspT107I GGYRCC 1 cut(s) 932
BsrDI GCAATG 1 cut(s) 755
BsrI ACTGG 4 cut(s) 56, 217, 365, 620
BssECI CCNNGG 2 cut(s) 220, 879
BssMI GATC 5 cut(s) 88, 190, 207, 688, 1225
Bst2UI CCWGG 3 cut(s) 75, 222, 1132
Bst4CI ACNGT 7 cut(s) 696, 839, 942, 956, 1052, 1120, 1172
BstC8I GCNNGC 3 cut(s) 543, 876, 1177
BstDEI CTNAG 3 cut(s) 171, 388, 821
BstEII GGTNACC 1 cut(s) 1055
BstF5I GGATG 3 cut(s) 364, 421, 1239
BstKTI GATC 5 cut(s) 91, 193, 210, 691, 1228
BstMAI GTCTC 3 cut(s) 123, 174, 681
BstMBI GATC 5 cut(s) 88, 190, 207, 688, 1225
BstMWI GCNNNNNNNGC 2 cut(s) 225, 460
BstNI CCWGG 3 cut(s) 75, 222, 1132
BstNSI RCATGY 2 cut(s) 874, 1069
BstPI GGTNACC 1 cut(s) 1055
BstSCI CCNGG 3 cut(s) 73, 220, 1130
BstSFI CTRYAG 2 cut(s) 762, 1161
BstSLI GKGCMC 1 cut(s) 935
BstV1I GCAGC 2 cut(s) 157, 1201
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
Bsu15I ATCGAT 1 cut(s) 1228
BsuI GTATCC 1 cut(s) 371
BsuRI GGCC 4 cut(s) 219, 374, 1155, 1179
BsuTUI ATCGAT 1 cut(s) 1228
BtsCI GGATG 3 cut(s) 364, 421, 1239
BtsIMutI CAGTG 2 cut(s) 210, 1057
Cac8I GCNNGC 3 cut(s) 543, 876, 1177
CaiI CAGNNNCTG 1 cut(s) 626
Cfr13I GGNCC 5 cut(s) 54, 218, 260, 372, 839
ClaI ATCGAT 1 cut(s) 1228
CsiI ACCWGGT 1 cut(s) 73
Csp6I GTAC 4 cut(s) 725, 952, 1086, 1168
CviAII CATG 7 cut(s) 327, 538, 871, 1061, 1066, 1140, 1219
CviQI GTAC 4 cut(s) 725, 952, 1086, 1168
DdeI CTNAG 3 cut(s) 171, 388, 821
DpnI GATC 5 cut(s) 90, 192, 209, 690, 1227
DpnII GATC 5 cut(s) 88, 190, 207, 688, 1225
EaeI YGGCCR 1 cut(s) 1153
Eco47I GGWCC 3 cut(s) 54, 260, 839
Eco57I CTGAAG 2 cut(s) 24, 293
Eco91I GGTNACC 1 cut(s) 1055
EcoO109I RGGNCCY 1 cut(s) 218
EcoO65I GGTNACC 1 cut(s) 1055
EcoRII CCWGG 3 cut(s) 73, 220, 1130
EcoT22I ATGCAT 2 cut(s) 328, 757
Esp3I CGTCTC 1 cut(s) 123
FaeI CATG 7 cut(s) 330, 541, 874, 1064, 1069, 1143, 1222
FalI AAGNNNNNCTT 4 cut(s) 643, 675, 900, 932
FaqI GGGAC 1 cut(s) 351
FatI CATG 7 cut(s) 326, 537, 870, 1060, 1065, 1139, 1218
Fnu4HI GCNGC 3 cut(s) 146, 1188, 1215
FokI GGATG 3 cut(s) 371, 428, 1246
Fsp4HI GCNGC 3 cut(s) 146, 1188, 1215
FspBI CTAG 2 cut(s) 231, 464
GluI GCNGC 3 cut(s) 146, 1188, 1215
GsuI CTGGAG 2 cut(s) 234, 1153
HaeIII GGCC 4 cut(s) 219, 374, 1155, 1179
HapII CCGG 1 cut(s) 375
Hin1II CATG 7 cut(s) 330, 541, 874, 1064, 1069, 1143, 1222
HinfI GANTC 8 cut(s) 107, 167, 339, 512, 592, 629, 1105, 1127
HpaII CCGG 1 cut(s) 375
HphI GGTGA 6 cut(s) 13, 98, 521, 697, 819, 1067
Hpy166II GTNNAC 5 cut(s) 727, 818, 827, 1088, 1123
Hpy188I TCNGA 6 cut(s) 174, 391, 688, 926, 1044, 1110
Hpy188III TCNNGA 2 cut(s) 111, 311
Hpy8I GTNNAC 5 cut(s) 727, 818, 827, 1088, 1123
HpyAV CCTTC 2 cut(s) 921, 1043
HpyCH4III ACNGT 7 cut(s) 696, 839, 942, 956, 1052, 1120, 1172
HpyCH4IV ACGT 1 cut(s) 14
HpyF10VI GCNNNNNNNGC 2 cut(s) 225, 460
HpyF3I CTNAG 3 cut(s) 171, 388, 821
HpySE526I ACGT 1 cut(s) 14
Hsp92II CATG 7 cut(s) 330, 541, 874, 1064, 1069, 1143, 1222
Kzo9I GATC 5 cut(s) 88, 190, 207, 688, 1225
Lsp1109I GCAGC 2 cut(s) 157, 1201
LweI GCATC 2 cut(s) 349, 901
MabI ACCWGGT 1 cut(s) 73
MaeI CTAG 2 cut(s) 231, 464
MaeII ACGT 1 cut(s) 14
MaeIII GTNAC 5 cut(s) 509, 622, 655, 1055, 1238
MalI GATC 5 cut(s) 90, 192, 209, 690, 1227
MboI GATC 5 cut(s) 88, 190, 207, 688, 1225
MboII GAAGA 1 cut(s) 83
MfeI CAATTG 1 cut(s) 1146
MflI RGATCY 1 cut(s) 190
MhlI GDGCHC 2 cut(s) 935, 1042
MlsI TGGCCA 1 cut(s) 1155
MluCI AATT 7 cut(s) 425, 446, 718, 1011, 1071, 1111, 1146
MluNI TGGCCA 1 cut(s) 1155
MlyI GAGTC 5 cut(s) 176, 333, 506, 1099, 1136
MmeI TCCRAC 1 cut(s) 666
MnlI CCTC 9 cut(s) 168, 204, 209, 460, 806, 889, 1017, 1086, 1128
Mox20I TGGCCA 1 cut(s) 1155
Mph1103I ATGCAT 2 cut(s) 328, 757
MscI TGGCCA 1 cut(s) 1155
MslI CAYNNNNRTG 4 cut(s) 441, 641, 850, 1093
Msp20I TGGCCA 1 cut(s) 1155
MspA1I CMGCKG 1 cut(s) 148
MspI CCGG 1 cut(s) 375
MspR9I CCNGG 3 cut(s) 75, 222, 1132
MunI CAATTG 1 cut(s) 1146
Mva1269I GAATGC 1 cut(s) 652
MvaI CCWGG 3 cut(s) 75, 222, 1132
MwoI GCNNNNNNNGC 2 cut(s) 225, 460
NdeII GATC 5 cut(s) 88, 190, 207, 688, 1225
NlaIII CATG 7 cut(s) 330, 541, 874, 1064, 1069, 1143, 1222
NlaIV GGNNCC 5 cut(s) 179, 373, 617, 738, 934
NmuCI GTSAC 2 cut(s) 509, 1055
NsiI ATGCAT 2 cut(s) 328, 757
NspI RCATGY 2 cut(s) 874, 1069
OliI CACNNNNGTG 1 cut(s) 850
PciI ACATGT 1 cut(s) 1065
PctI GAATGC 1 cut(s) 652
PfeI GAWTC 3 cut(s) 107, 592, 629
PflFI GACNNNGTC 1 cut(s) 1141
PfoI TCCNGGA 1 cut(s) 1130
PkrI GCNGC 3 cut(s) 147, 1189, 1216
PleI GAGTC 5 cut(s) 175, 333, 506, 1099, 1135
PpsI GAGTC 5 cut(s) 175, 333, 506, 1099, 1135
PscI ACATGT 1 cut(s) 1065
PsiI TTATAA 1 cut(s) 864
Psp6I CCWGG 3 cut(s) 73, 220, 1130
PspEI GGTNACC 1 cut(s) 1055
PspGI CCWGG 3 cut(s) 73, 220, 1130
PspN4I GGNNCC 5 cut(s) 179, 373, 617, 738, 934
PspPI GGNCC 5 cut(s) 54, 218, 260, 372, 839
PstI CTGCAG 1 cut(s) 1165
PstNI CAGNNNCTG 1 cut(s) 626
PsuI RGATCY 1 cut(s) 190
PsyI GACNNNGTC 1 cut(s) 1141
PvuII CAGCTG 1 cut(s) 148
RsaI GTAC 4 cut(s) 726, 953, 1087, 1169
RsaNI GTAC 4 cut(s) 725, 952, 1086, 1168
RseI CAYNNNNRTG 4 cut(s) 441, 641, 850, 1093
SatI GCNGC 3 cut(s) 146, 1188, 1215
Sau3AI GATC 5 cut(s) 88, 190, 207, 688, 1225
Sau96I GGNCC 5 cut(s) 54, 218, 260, 372, 839
ScaI AGTACT 1 cut(s) 953
SchI GAGTC 5 cut(s) 176, 333, 506, 1099, 1136
ScrFI CCNGG 3 cut(s) 75, 222, 1132
SduI GDGCHC 2 cut(s) 935, 1042
SexAI ACCWGGT 1 cut(s) 73
SfaNI GCATC 2 cut(s) 349, 901
SfcI CTRYAG 2 cut(s) 762, 1161
SinI GGWCC 3 cut(s) 54, 260, 839
SmiMI CAYNNNNRTG 4 cut(s) 441, 641, 850, 1093
Sse9I AATT 7 cut(s) 425, 446, 718, 1011, 1071, 1111, 1146
SsiI CCGC 1 cut(s) 1187
SspMI CTAG 2 cut(s) 231, 464
StyD4I CCNGG 3 cut(s) 73, 220, 1130
TaaI ACNGT 7 cut(s) 696, 839, 942, 956, 1052, 1120, 1172
TaiI ACGT 1 cut(s) 17
TaqI TCGA 3 cut(s) 165, 856, 1228
TasI AATT 7 cut(s) 425, 446, 718, 1011, 1071, 1111, 1146
TatI WGTACW 1 cut(s) 951
TauI GCSGC 1 cut(s) 1190
TfiI GAWTC 3 cut(s) 107, 592, 629
TscAI CASTG 2 cut(s) 217, 1057
TseFI GTSAC 2 cut(s) 509, 1055
TseI GCWGC 2 cut(s) 145, 1214
Tsp45I GTSAC 2 cut(s) 509, 1055
TspDTI ATGAA 5 cut(s) 150, 459, 582, 605, 659
TspRI CASTG 2 cut(s) 217, 1057
Tth111I GACNNNGTC 1 cut(s) 1141
VpaK11BI GGWCC 3 cut(s) 54, 260, 839
XapI RAATTY 5 cut(s) 425, 446, 718, 1011, 1111
XceI RCATGY 2 cut(s) 874, 1069
XcmI CCANNNNNNNNNTGG 1 cut(s) 914
XspI CTAG 2 cut(s) 231, 464
ZrmI AGTACT 1 cut(s) 953
Zsp2I ATGCAT 2 cut(s) 328, 757
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.