Rmu_co8150836.1_g000001

Cullin-associated NEDD8-dissociated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8150836.1
Physical Location & Seq
Reverse (-)
1 .. 541
541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8150836.1_g000001.1.cds

Sequence Viewer

Length: 331 bp
atgacaaataagctttgtgagaaattgctaaaggagaaggatcaacatcgtgacattgccagcatagctatgaaggctattgttgcagaagtttctactcaatcacttgcacagtctattcttgtgtctattttacctcagttgattaaaggaattactgccccaggaatgagcacagagataaaatgtgaatgtcttgatatcttatgtgatgtccttcataagtttggcaatcttatggcaaccgaccatgagctactattaggtgctctcttgtctcagttgagttccaatcaggccagcgtgaggaagaaaactgtgtcatgcatcg

Protein Analysis

110

Amino Acids

11.95

Weight (kDa)

7.64

Isoelectric Point (pI)

44.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 48
AfiI CCNNNNNNNGG 1 cut(s) 306
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 3 cut(s) 13, 68, 256
AluI AGCT 3 cut(s) 13, 68, 256
Alw21I GWGCWC 2 cut(s) 176, 271
Alw26I GTCTC 1 cut(s) 282
AlwI GGATC 1 cut(s) 48
AoxI GGCC 1 cut(s) 297
Bbv12I GWGCWC 2 cut(s) 176, 271
BciT130I CCWGG 1 cut(s) 165
BcoDI GTCTC 1 cut(s) 282
Bme1390I CCNGG 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 165
BsaBI GATNNNNATC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 306
Bse3DI GCAATG 1 cut(s) 54
Bse8I GATNNNNATC 1 cut(s) 45
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 163
BseJI GATNNNNATC 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 306
BseMI GCAATG 1 cut(s) 54
BseMII CTCAG 2 cut(s) 152, 293
BshFI GGCC 1 cut(s) 299
BsiHKAI GWGCWC 2 cut(s) 176, 271
BslI CCNNNNNNNGG 1 cut(s) 306
BsmAI GTCTC 1 cut(s) 282
BsnI GGCC 1 cut(s) 299
Bsp1286I GDGCHC 2 cut(s) 176, 271
Bsp143I GATC 1 cut(s) 40
BspANI GGCC 1 cut(s) 299
BspCNI CTCAG 2 cut(s) 151, 292
BspPI GGATC 1 cut(s) 48
BsrDI GCAATG 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 2 cut(s) 114, 319
BstC8I GCNNGC 2 cut(s) 61, 301
BstDEI CTNAG 2 cut(s) 138, 279
BstKTI GATC 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 282
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 3 cut(s) 65, 74, 83
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BsuRI GGCC 1 cut(s) 299
Cac8I GCNNGC 2 cut(s) 61, 301
CviAII CATG 2 cut(s) 251, 324
CviJI RGCY 5 cut(s) 13, 68, 77, 256, 299
CviKI_1 RGCY 5 cut(s) 13, 68, 77, 256, 299
DdeI CTNAG 2 cut(s) 138, 279
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco32I GATATC 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 163
EcoRV GATATC 1 cut(s) 202
EcoT22I ATGCAT 1 cut(s) 329
FaeI CATG 2 cut(s) 254, 327
FaiI YATR 7 cut(s) 65, 71, 208, 222, 239, 252, 325
FatI CATG 2 cut(s) 250, 323
HaeIII GGCC 1 cut(s) 299
Hin1II CATG 2 cut(s) 254, 327
HindIII AAGCTT 1 cut(s) 11
Hpy188III TCNNGA 2 cut(s) 50, 197
HpyAV CCTTC 3 cut(s) 31, 67, 227
HpyCH4III ACNGT 2 cut(s) 114, 319
HpyCH4V TGCA 3 cut(s) 86, 110, 327
HpyF10VI GCNNNNNNNGC 3 cut(s) 65, 74, 83
HpyF3I CTNAG 2 cut(s) 138, 279
Hsp92II CATG 2 cut(s) 254, 327
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 5 cut(s) 73, 150, 177, 281, 313
MaeIII GTNAC 1 cut(s) 50
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 1 cut(s) 322
MhlI GDGCHC 2 cut(s) 176, 271
MluCI AATT 2 cut(s) 23, 153
MnlI CCTC 2 cut(s) 147, 300
Mph1103I ATGCAT 1 cut(s) 329
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 68
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
MwoI GCNNNNNNNGC 3 cut(s) 65, 74, 83
NdeII GATC 1 cut(s) 40
NlaIII CATG 2 cut(s) 254, 327
NmuCI GTSAC 1 cut(s) 50
NsiI ATGCAT 1 cut(s) 329
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
RseI CAYNNNNRTG 1 cut(s) 68
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 1 cut(s) 40
ScrFI CCNGG 1 cut(s) 165
SduI GDGCHC 2 cut(s) 176, 271
SetI ASST 5 cut(s) 15, 70, 139, 258, 268
SmiMI CAYNNNNRTG 1 cut(s) 68
Sse9I AATT 2 cut(s) 23, 153
StyD4I CCNGG 1 cut(s) 163
TaaI ACNGT 2 cut(s) 114, 319
TasI AATT 2 cut(s) 23, 153
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 86, 209
Zsp2I ATGCAT 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.