Rh7BG317500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
30770351 .. 30770966
616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG317500.1

Sequence Viewer

Length: 429 bp
ATGTCTAAGCTTGTAACTTCTGGTAGTGTTGCTCTCTATCATGGATACAATGAACACAAGCGATTCAAATGTGTTAACAATATCAAGATATCACTTCTAGTGGGGTTATTTGGATCAGGTGACACACAAGAAGCATTTCAAGTTCTTCATACTATTCTGACTCCATTTCTTATTGCTGATTACTACCATGCAAGGTCACCCAATGCTTTTGGAGCTACCTCAAAATGGCAATTAAATGGTTTGGAATCGGGTGAACAATTTCTATATGTTGATTATGTCCTTTCCATTCTCATAAAAGAAAGACTCTGTTGTACCTCGTGGTTCAATACCTATATTGATACACTACCAAGTGAACCTCACATTGGGACAAATTCTGGAGTTATGAAAGTGATGGGTGTGAAGGAAGCCTTGCTCTTGAGAAAGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

15.92

Weight (kDa)

8.43

Isoelectric Point (pI)

31.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 121
AcsI RAATTY 1 cut(s) 370
AfaI GTAC 1 cut(s) 313
AfiI CCNNNNNNNGG 2 cut(s) 225, 362
AgsI TTSAA 3 cut(s) 67, 140, 325
AjuI GAANNNNNNNTTGG 2 cut(s) 345, 377
AluBI AGCT 2 cut(s) 10, 215
AluI AGCT 2 cut(s) 10, 215
AlwI GGATC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 370
Asp700I GAANNNNTTC 2 cut(s) 135, 258
AsuHPI GGTGA 3 cut(s) 131, 189, 263
BauI CACGAG 1 cut(s) 316
BccI CCATC 1 cut(s) 385
BciVI GTATCC 1 cut(s) 38
BfaI CTAG 1 cut(s) 98
BfuI GTATCC 1 cut(s) 38
BpmI CTGGAG 1 cut(s) 396
Bsc4I CCNNNNNNNGG 2 cut(s) 225, 362
BseLI CCNNNNNNNGG 2 cut(s) 225, 362
BslFI GGGAC 1 cut(s) 379
BslI CCNNNNNNNGG 2 cut(s) 225, 362
BsmFI GGGAC 1 cut(s) 379
Bsp143I GATC 1 cut(s) 113
BspPI GGATC 1 cut(s) 121
BssMI GATC 1 cut(s) 113
BssSI CACGAG 1 cut(s) 316
Bst2BI CACGAG 1 cut(s) 316
BstDEI CTNAG 1 cut(s) 6
BstEII GGTNACC 1 cut(s) 195
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstPI GGTNACC 1 cut(s) 195
BsuI GTATCC 1 cut(s) 38
Csp6I GTAC 1 cut(s) 312
CviAII CATG 2 cut(s) 41, 188
CviJI RGCY 3 cut(s) 10, 215, 407
CviKI_1 RGCY 3 cut(s) 10, 215, 407
CviQI GTAC 1 cut(s) 312
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
Eco32I GATATC 1 cut(s) 90
Eco91I GGTNACC 1 cut(s) 195
EcoO65I GGTNACC 1 cut(s) 195
EcoRV GATATC 1 cut(s) 90
FaeI CATG 2 cut(s) 44, 191
FaiI YATR 9 cut(s) 42, 150, 189, 265, 267, 276, 293, 333, 383
FalI AAGNNNNNCTT 2 cut(s) 392, 424
FaqI GGGAC 1 cut(s) 379
FatI CATG 2 cut(s) 40, 187
FspBI CTAG 1 cut(s) 98
GsuI CTGGAG 1 cut(s) 396
Hin1II CATG 2 cut(s) 44, 191
HincII GTYRAC 1 cut(s) 76
HindII GTYRAC 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 8
HinfI GANTC 4 cut(s) 63, 160, 245, 303
HpaI GTTAAC 1 cut(s) 76
HphI GGTGA 3 cut(s) 131, 189, 263
Hpy166II GTNNAC 3 cut(s) 76, 254, 353
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 3 cut(s) 85, 375, 415
Hpy8I GTNNAC 3 cut(s) 76, 254, 353
HpyAV CCTTC 1 cut(s) 394
HpyCH4V TGCA 1 cut(s) 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 2 cut(s) 44, 191
KspAI GTTAAC 1 cut(s) 76
Kzo9I GATC 1 cut(s) 113
LmnI GCTCC 1 cut(s) 212
LpnPI CCDG 3 cut(s) 6, 102, 360
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 3 cut(s) 13, 119, 195
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MboII GAAGA 1 cut(s) 137
MluCI AATT 4 cut(s) 230, 257, 370, 424
MlyI GAGTC 2 cut(s) 154, 297
MnlI CCTC 3 cut(s) 229, 325, 366
MroXI GAANNNNTTC 2 cut(s) 135, 258
MseI TTAA 3 cut(s) 75, 233, 427
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeII GATC 1 cut(s) 113
NlaIII CATG 2 cut(s) 44, 191
NmuCI GTSAC 2 cut(s) 119, 195
PdmI GAANNNNTTC 2 cut(s) 135, 258
PfeI GAWTC 2 cut(s) 63, 245
PleI GAGTC 2 cut(s) 154, 297
PpsI GAGTC 2 cut(s) 154, 297
PspEI GGTNACC 1 cut(s) 195
RsaI GTAC 1 cut(s) 313
RsaNI GTAC 1 cut(s) 312
SaqAI TTAA 3 cut(s) 75, 233, 427
Sau3AI GATC 1 cut(s) 113
SchI GAGTC 2 cut(s) 154, 297
SetI ASST 8 cut(s) 12, 121, 197, 217, 221, 317, 332, 358
SmlI CTYRAG 1 cut(s) 415
SmoI CTYRAG 1 cut(s) 415
Sse9I AATT 4 cut(s) 230, 257, 370, 424
SspMI CTAG 1 cut(s) 98
TasI AATT 4 cut(s) 230, 257, 370, 424
TfiI GAWTC 2 cut(s) 63, 245
Tru1I TTAA 3 cut(s) 75, 233, 427
Tru9I TTAA 3 cut(s) 75, 233, 427
TseFI GTSAC 2 cut(s) 119, 195
Tsp45I GTSAC 2 cut(s) 119, 195
TspDTI ATGAA 3 cut(s) 66, 137, 398
XapI RAATTY 1 cut(s) 370
XmnI GAANNNNTTC 2 cut(s) 135, 258
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.