Rmu_co8186534.1_g000001

Belongs to the glycosyl hydrolase 31 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8186534.1
Physical Location & Seq
Forward (+)
1 .. 689
689 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8186534.1_g000001.1.cds

Sequence Viewer

Length: 483 bp
gttccaatggttggagctgatatatgtggtttctctggggatactaatgaagaactctgccggcgttggattcagctaggggccttttacccgttttcaagagatcactcagacaagaattcaatccggcaagagctctatctttgggaatcagttgcagcatcagcaaagaaggtgctggggctgcgataccggttgcttcccttgttctacacatcaatgtatcaagcacacaagaacgggaccccaattgcaaggcccgtattcttctcatttcctgaagataccaatacatacgacatcagttcacagtttctgattggtaaaggcgtgatggtatcacctgtgttgcagcaaggagcaaattcagttgaggcgtattttcctgctggaaactggaaacatattggccttgcaaggagaggccttgacaacacaagcagcccgaaacactacattcgaacttttggtggtcactggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

160

Amino Acids

18.08

Weight (kDa)

9.15

Isoelectric Point (pI)

55.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 11
AcsI RAATTY 2 cut(s) 118, 364
AcuI CTGAAG 1 cut(s) 300
AfiI CCNNNNNNNGG 1 cut(s) 11
AgeI ACCGGT 1 cut(s) 192
AgsI TTSAA 2 cut(s) 99, 123
AluBI AGCT 3 cut(s) 17, 76, 136
AluI AGCT 3 cut(s) 17, 76, 136
Alw21I GWGCWC 1 cut(s) 138
AlwNI CAGNNNCTG 1 cut(s) 316
AoxI GGCC 4 cut(s) 81, 257, 409, 424
ApeKI GCWGC 4 cut(s) 158, 184, 352, 441
ApoI RAATTY 2 cut(s) 118, 364
AsiGI ACCGGT 1 cut(s) 192
AspS9I GGNCC 3 cut(s) 81, 243, 258
AsuHPI GGTGA 1 cut(s) 333
AsuII TTCGAA 1 cut(s) 460
AvaII GGWCC 1 cut(s) 243
BanII GRGCYC 1 cut(s) 138
Bbv12I GWGCWC 1 cut(s) 138
BbvI GCAGC 4 cut(s) 170, 171, 364, 453
BccI CCATC 1 cut(s) 328
BciVI GTATCC 1 cut(s) 34
BfaI CTAG 1 cut(s) 77
BfuI GTATCC 1 cut(s) 34
BisI GCNGC 4 cut(s) 159, 185, 353, 442
BlsI GCNGC 4 cut(s) 160, 186, 354, 443
Bme18I GGWCC 1 cut(s) 243
BmgT120I GGNCC 3 cut(s) 81, 243, 258
BmiI GGNNCC 3 cut(s) 82, 244, 245
BmsI GCATC 1 cut(s) 170
Bpu14I TTCGAA 1 cut(s) 460
BsaWI WCCGGW 1 cut(s) 192
Bsc4I CCNNNNNNNGG 1 cut(s) 11
Bse118I RCCGGY 2 cut(s) 60, 192
Bse1I ACTGG 2 cut(s) 401, 482
BseLI CCNNNNNNNGG 1 cut(s) 11
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 2 cut(s) 401, 482
BseXI GCAGC 4 cut(s) 170, 171, 364, 453
BseYI CCCAGC 1 cut(s) 178
BshFI GGCC 4 cut(s) 83, 259, 411, 426
BshTI ACCGGT 1 cut(s) 192
BsiHKAI GWGCWC 1 cut(s) 138
BsiSI CCGG 3 cut(s) 61, 127, 193
BslFI GGGAC 1 cut(s) 256
BslI CCNNNNNNNGG 1 cut(s) 11
BsmFI GGGAC 1 cut(s) 256
BsnI GGCC 4 cut(s) 83, 259, 411, 426
Bsp119I TTCGAA 1 cut(s) 460
Bsp1286I GDGCHC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 103
BspANI GGCC 4 cut(s) 83, 259, 411, 426
BspCNI CTCAG 1 cut(s) 122
BspLI GGNNCC 3 cut(s) 82, 244, 245
BspT104I TTCGAA 1 cut(s) 460
BsrFI RCCGGY 2 cut(s) 60, 192
BsrI ACTGG 2 cut(s) 401, 482
BssAI RCCGGY 2 cut(s) 60, 192
BssMI GATC 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 312
BstBI TTCGAA 1 cut(s) 460
BstC8I GCNNGC 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 109
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstMWI GCNNNNNNNGC 2 cut(s) 164, 184
BstV1I GCAGC 4 cut(s) 170, 171, 364, 453
BsuI GTATCC 1 cut(s) 34
BsuRI GGCC 4 cut(s) 83, 259, 411, 426
BtsIMutI CAGTG 1 cut(s) 475
Cac8I GCNNGC 1 cut(s) 62
CaiI CAGNNNCTG 1 cut(s) 316
Cfr10I RCCGGY 2 cut(s) 60, 192
Cfr13I GGNCC 3 cut(s) 81, 243, 258
CspAI ACCGGT 1 cut(s) 192
CviJI RGCY 9 cut(s) 17, 76, 83, 136, 184, 259, 411, 426, 444
CviKI_1 RGCY 9 cut(s) 17, 76, 83, 136, 184, 259, 411, 426, 444
DdeI CTNAG 1 cut(s) 109
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Ecl136II GAGCTC 1 cut(s) 136
Eco147I AGGCCT 1 cut(s) 426
Eco24I GRGCYC 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 243
Eco53kI GAGCTC 1 cut(s) 136
Eco57I CTGAAG 1 cut(s) 300
EcoICRI GAGCTC 1 cut(s) 136
EcoO109I RGGNCCY 2 cut(s) 81, 243
EcoRI GAATTC 1 cut(s) 118
EcoT38I GRGCYC 1 cut(s) 138
FaiI YATR 4 cut(s) 23, 25, 295, 405
FaqI GGGAC 1 cut(s) 256
Fnu4HI GCNGC 4 cut(s) 159, 185, 353, 442
FriOI GRGCYC 1 cut(s) 138
Fsp4HI GCNGC 4 cut(s) 159, 185, 353, 442
FspBI CTAG 1 cut(s) 77
GluI GCNGC 4 cut(s) 159, 185, 353, 442
GsaI CCCAGC 1 cut(s) 182
HaeIII GGCC 4 cut(s) 83, 259, 411, 426
HapII CCGG 3 cut(s) 61, 127, 193
HinfI GANTC 2 cut(s) 70, 149
HpaII CCGG 3 cut(s) 61, 127, 193
HphI GGTGA 1 cut(s) 333
Hpy166II GTNNAC 1 cut(s) 308
Hpy188I TCNGA 2 cut(s) 112, 318
Hpy188III TCNNGA 2 cut(s) 99, 278
Hpy8I GTNNAC 1 cut(s) 308
HpyAV CCTTC 1 cut(s) 166
HpyCH4III ACNGT 1 cut(s) 312
HpyCH4V TGCA 4 cut(s) 158, 254, 352, 416
HpyF10VI GCNNNNNNNGC 2 cut(s) 164, 184
HpyF3I CTNAG 1 cut(s) 109
KflI GGGWCCC 1 cut(s) 243
KroI GCCGGC 1 cut(s) 60
KroNI GCCGGC 1 cut(s) 62
Kzo9I GATC 1 cut(s) 103
LmnI GCTCC 2 cut(s) 14, 359
Lsp1109I GCAGC 4 cut(s) 170, 171, 364, 453
LweI GCATC 1 cut(s) 170
MaeI CTAG 1 cut(s) 77
MaeIII GTNAC 1 cut(s) 473
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 3 cut(s) 62, 259, 293
MfeI CAATTG 1 cut(s) 249
MhlI GDGCHC 1 cut(s) 138
MluCI AATT 3 cut(s) 118, 249, 364
MmeI TCCRAC 1 cut(s) 47
MnlI CCTC 2 cut(s) 367, 416
MroNI GCCGGC 1 cut(s) 60
MslI CAYNNNNRTG 1 cut(s) 218
MspI CCGG 3 cut(s) 61, 127, 193
MunI CAATTG 1 cut(s) 249
MwoI GCNNNNNNNGC 2 cut(s) 164, 184
NaeI GCCGGC 1 cut(s) 62
NdeII GATC 1 cut(s) 103
NgoMIV GCCGGC 1 cut(s) 60
NlaIV GGNNCC 3 cut(s) 82, 244, 245
NmuCI GTSAC 1 cut(s) 473
NspV TTCGAA 1 cut(s) 460
PceI AGGCCT 1 cut(s) 426
PdiI GCCGGC 1 cut(s) 62
PfeI GAWTC 2 cut(s) 70, 149
PflMI CCANNNNNTGG 1 cut(s) 11
PinAI ACCGGT 1 cut(s) 192
PkrI GCNGC 4 cut(s) 160, 186, 354, 443
PpuMI RGGWCCY 1 cut(s) 243
Psp124BI GAGCTC 1 cut(s) 138
Psp5II RGGWCCY 1 cut(s) 243
PspFI CCCAGC 1 cut(s) 178
PspN4I GGNNCC 3 cut(s) 82, 244, 245
PspPI GGNCC 3 cut(s) 81, 243, 258
PspPPI RGGWCCY 1 cut(s) 243
PstNI CAGNNNCTG 1 cut(s) 316
RseI CAYNNNNRTG 1 cut(s) 218
SacI GAGCTC 1 cut(s) 138
SatI GCNGC 4 cut(s) 159, 185, 353, 442
Sau3AI GATC 1 cut(s) 103
Sau96I GGNCC 3 cut(s) 81, 243, 258
SduI GDGCHC 1 cut(s) 138
SetI ASST 5 cut(s) 19, 78, 138, 177, 346
SfaNI GCATC 1 cut(s) 170
SfuI TTCGAA 1 cut(s) 460
SinI GGWCC 1 cut(s) 243
SmiMI CAYNNNNRTG 1 cut(s) 218
Sse9I AATT 3 cut(s) 118, 249, 364
SseBI AGGCCT 1 cut(s) 426
SspMI CTAG 1 cut(s) 77
SstI GAGCTC 1 cut(s) 138
StuI AGGCCT 1 cut(s) 426
TaaI ACNGT 1 cut(s) 312
TaqI TCGA 1 cut(s) 460
TasI AATT 3 cut(s) 118, 249, 364
TfiI GAWTC 2 cut(s) 70, 149
TscAI CASTG 1 cut(s) 482
TseFI GTSAC 1 cut(s) 473
TseI GCWGC 4 cut(s) 158, 184, 352, 441
Tsp45I GTSAC 1 cut(s) 473
TspDTI ATGAA 1 cut(s) 63
TspRI CASTG 1 cut(s) 482
Van91I CCANNNNNTGG 1 cut(s) 11
VpaK11BI GGWCC 1 cut(s) 243
XapI RAATTY 2 cut(s) 118, 364
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.