Rmu_co8378957.1_g000001

Belongs to the glycosyl hydrolase 31 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8378957.1
Physical Location & Seq
Reverse (-)
2 .. 1114
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8378957.1_g000001.1.cds

Sequence Viewer

Length: 923 bp
atgggaaatttttgtttttgttttgtttatttcatatatatagttgctattcattttgatattgtgttctctcttgaaggattccaccagtgtagatatggttacaaggatgtttctgatcttgagggggtcgttgctggttatgcaaatgctagtatccctcttgaggttatgtggacagacattgattacatggatgcttacaaggatttcactcttgatcccgtcaactttccattagacaggatgaagaactttaccaacaaccttcaccaaaatggtcagaaatacgtgcttatcttggatcccggtattagtatcaatgatagctatggaacctacaccagagggaaggaagcagatatatttataaaacgtgatggcattccttaccagggaaatgtttggcctggcaatgtttactttcctgattttgtaaatccacaaagtgaaccatattgggagaatgagattaaactatttctagaccagctacctgttgatggcctttggcttgatatgaatgaagtatcaaatttccaaacttctaatcccactccgaattccacacttgatgatccaccttacaaaatcaacgatgctggaggccaccgtccgatccttagtaggactattccaggatcagctctacactttggtaatgttacagagtataatgttcataacctatttggcatgttagaagccaaagcaacaaacaaggccttgaccaatttgactggtaagagaccttttgttctctcgagatcgacttttgtaagctctggtaagtacacagcacactggaccggagacaatggtgcaaaatggagtgatttggcatactcaattccgggcattttgaattttggactctttggagttccaatggttggagctgatatatgtggtttctctgggga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

307

Amino Acids

34.47

Weight (kDa)

4.9

Isoelectric Point (pI)

15.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 371
AccB7I CCANNNNNTGG 1 cut(s) 893
AclWI GGATC 6 cut(s) 215, 299, 312, 572, 613, 649
AcsI RAATTY 4 cut(s) 7, 535, 562, 865
AdeI CACNNNGTG 1 cut(s) 449
AfaI GTAC 1 cut(s) 794
AfiI CCNNNNNNNGG 4 cut(s) 166, 395, 503, 893
AgsI TTSAA 2 cut(s) 77, 865
AjnI CCWGG 3 cut(s) 393, 409, 637
AluBI AGCT 5 cut(s) 330, 493, 647, 783, 899
AluI AGCT 5 cut(s) 330, 493, 647, 783, 899
Alw26I GTCTC 2 cut(s) 742, 807
AlwI GGATC 6 cut(s) 215, 299, 312, 572, 613, 649
Ama87I CYCGRG 1 cut(s) 763
AoxI GGCC 4 cut(s) 407, 505, 607, 723
ApoI RAATTY 4 cut(s) 7, 535, 562, 865
AspS9I GGNCC 1 cut(s) 807
AsuC2I CCSGG 2 cut(s) 309, 855
AsuHPI GGTGA 1 cut(s) 263
AvaI CYCGRG 1 cut(s) 763
AvaII GGWCC 1 cut(s) 807
BamHI GGATCC 1 cut(s) 304
BccI CCATC 2 cut(s) 374, 497
BciT130I CCWGG 3 cut(s) 395, 411, 639
BciVI GTATCC 1 cut(s) 167
BcnI CCSGG 2 cut(s) 309, 855
BcoDI GTCTC 2 cut(s) 742, 807
BfaI CTAG 2 cut(s) 153, 485
BfuI GTATCC 1 cut(s) 167
Bme1390I CCNGG 5 cut(s) 309, 395, 411, 639, 855
Bme18I GGWCC 1 cut(s) 807
BmeT110I CYCGRG 1 cut(s) 763
BmgT120I GGNCC 1 cut(s) 807
BmiI GGNNCC 2 cut(s) 306, 337
BmrFI CCNGG 5 cut(s) 309, 395, 411, 639, 855
BmsI GCATC 2 cut(s) 187, 589
BpmI CTGGAG 1 cut(s) 624
BpuEI CTTGAG 2 cut(s) 143, 185
BpuMI CCSGG 2 cut(s) 309, 855
BsaAI YACGTR 1 cut(s) 292
BsaI GGTCTC 1 cut(s) 742
BsaJI CCNNGG 1 cut(s) 394
BsaWI WCCGGW 1 cut(s) 809
Bsc4I CCNNNNNNNGG 4 cut(s) 166, 395, 503, 893
Bse1I ACTGG 3 cut(s) 88, 745, 809
Bse3DI GCAATG 1 cut(s) 421
BseBI CCWGG 3 cut(s) 395, 411, 639
BseDI CCNNGG 1 cut(s) 394
BseGI GGATG 3 cut(s) 115, 202, 252
BseLI CCNNNNNNNGG 4 cut(s) 166, 395, 503, 893
BseMI GCAATG 1 cut(s) 421
BseNI ACTGG 3 cut(s) 88, 745, 809
BshFI GGCC 4 cut(s) 409, 507, 609, 725
BsiHKCI CYCGRG 1 cut(s) 763
BsiSI CCGG 3 cut(s) 309, 810, 854
BslI CCNNNNNNNGG 4 cut(s) 166, 395, 503, 893
BsmAI GTCTC 2 cut(s) 742, 807
BsmI GAATGC 1 cut(s) 384
BsnI GGCC 4 cut(s) 409, 507, 609, 725
Bso31I GGTCTC 1 cut(s) 742
BsoBI CYCGRG 1 cut(s) 763
Bsp143I GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
BspANI GGCC 4 cut(s) 409, 507, 609, 725
BspLI GGNNCC 2 cut(s) 306, 337
BspPI GGATC 6 cut(s) 215, 299, 312, 572, 613, 649
BspTNI GGTCTC 1 cut(s) 742
BsrDI GCAATG 1 cut(s) 421
BsrI ACTGG 3 cut(s) 88, 745, 809
BssECI CCNNGG 1 cut(s) 394
BssMI GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
Bst2UI CCWGG 3 cut(s) 395, 411, 639
Bst4CI ACNGT 1 cut(s) 614
BstBAI YACGTR 1 cut(s) 292
BstDEI CTNAG 1 cut(s) 623
BstF5I GGATG 3 cut(s) 115, 202, 252
BstKTI GATC 7 cut(s) 121, 223, 307, 580, 621, 644, 770
BstMAI GTCTC 2 cut(s) 742, 807
BstMBI GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
BstMWI GCNNNNNNNGC 1 cut(s) 143
BstNI CCWGG 3 cut(s) 395, 411, 639
BstNSI RCATGY 1 cut(s) 700
BstSCI CCNGG 5 cut(s) 307, 393, 409, 637, 853
BstX2I RGATCY 1 cut(s) 304
BstYI RGATCY 1 cut(s) 304
BsuI GTATCC 1 cut(s) 167
BsuRI GGCC 4 cut(s) 409, 507, 609, 725
BtsCI GGATG 3 cut(s) 115, 202, 252
BtsIMutI CAGTG 2 cut(s) 95, 802
Cfr13I GGNCC 1 cut(s) 807
Csp6I GTAC 1 cut(s) 793
CviAII CATG 2 cut(s) 193, 697
CviQI GTAC 1 cut(s) 793
DdeI CTNAG 1 cut(s) 623
DpnI GATC 7 cut(s) 120, 222, 306, 579, 620, 643, 769
DpnII GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
DraIII CACNNNGTG 1 cut(s) 449
Eco147I AGGCCT 1 cut(s) 725
Eco31I GGTCTC 1 cut(s) 742
Eco47I GGWCC 1 cut(s) 807
Eco88I CYCGRG 1 cut(s) 763
EcoRI GAATTC 1 cut(s) 562
EcoRII CCWGG 3 cut(s) 393, 409, 637
FaeI CATG 2 cut(s) 196, 700
FatI CATG 2 cut(s) 192, 696
FokI GGATG 3 cut(s) 122, 209, 259
FspBI CTAG 2 cut(s) 153, 485
GsuI CTGGAG 1 cut(s) 624
HaeIII GGCC 4 cut(s) 409, 507, 609, 725
HapII CCGG 3 cut(s) 309, 810, 854
Hin1II CATG 2 cut(s) 196, 700
HincII GTYRAC 1 cut(s) 229
HindII GTYRAC 1 cut(s) 229
HinfI GANTC 2 cut(s) 81, 873
HpaII CCGG 3 cut(s) 309, 810, 854
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 5 cut(s) 177, 229, 421, 452, 795
Hpy188I TCNGA 4 cut(s) 118, 285, 561, 618
Hpy188III TCNNGA 8 cut(s) 74, 122, 164, 218, 428, 485, 763, 765
Hpy8I GTNNAC 5 cut(s) 177, 229, 421, 452, 795
HpyAV CCTTC 3 cut(s) 71, 278, 346
HpyCH4III ACNGT 1 cut(s) 614
HpyCH4IV ACGT 2 cut(s) 291, 376
HpyCH4V TGCA 2 cut(s) 146, 824
HpyF10VI GCNNNNNNNGC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 623
HpySE526I ACGT 2 cut(s) 291, 376
Hsp92II CATG 2 cut(s) 196, 700
Kzo9I GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
LmnI GCTCC 1 cut(s) 896
LweI GCATC 2 cut(s) 187, 589
MaeI CTAG 2 cut(s) 153, 485
MaeII ACGT 2 cut(s) 291, 376
MaeIII GTNAC 2 cut(s) 101, 664
MalI GATC 7 cut(s) 120, 222, 306, 579, 620, 643, 769
MboI GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
MboII GAAGA 1 cut(s) 262
MflI RGATCY 1 cut(s) 304
MluCI AATT 6 cut(s) 7, 535, 562, 733, 849, 865
MlyI GAGTC 1 cut(s) 867
MmeI TCCRAC 1 cut(s) 874
MnlI CCTC 5 cut(s) 118, 160, 171, 341, 599
MseI TTAA 1 cut(s) 474
MslI CAYNNNNRTG 1 cut(s) 276
MspI CCGG 3 cut(s) 309, 810, 854
MspR9I CCNGG 5 cut(s) 309, 395, 411, 639, 855
Mva1269I GAATGC 1 cut(s) 384
MvaI CCWGG 3 cut(s) 395, 411, 639
MwoI GCNNNNNNNGC 1 cut(s) 143
NciI CCSGG 2 cut(s) 309, 855
NdeII GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
NlaIII CATG 2 cut(s) 196, 700
NlaIV GGNNCC 2 cut(s) 306, 337
NspI RCATGY 1 cut(s) 700
PaeR7I CTCGAG 1 cut(s) 763
PceI AGGCCT 1 cut(s) 725
PctI GAATGC 1 cut(s) 384
PfeI GAWTC 1 cut(s) 81
PflMI CCANNNNNTGG 1 cut(s) 893
PfoI TCCNGGA 1 cut(s) 637
PleI GAGTC 1 cut(s) 867
PpsI GAGTC 1 cut(s) 867
Ppu21I YACGTR 1 cut(s) 292
PsiI TTATAA 1 cut(s) 371
Psp6I CCWGG 3 cut(s) 393, 409, 637
PspGI CCWGG 3 cut(s) 393, 409, 637
PspN4I GGNNCC 2 cut(s) 306, 337
PspPI GGNCC 1 cut(s) 807
PsuI RGATCY 1 cut(s) 304
RsaI GTAC 1 cut(s) 794
RsaNI GTAC 1 cut(s) 793
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 1 cut(s) 474
Sau3AI GATC 7 cut(s) 118, 220, 304, 577, 618, 641, 767
Sau96I GGNCC 1 cut(s) 807
SchI GAGTC 1 cut(s) 867
ScrFI CCNGG 5 cut(s) 309, 395, 411, 639, 855
SfaNI GCATC 2 cut(s) 187, 589
Sfr274I CTCGAG 1 cut(s) 763
SinI GGWCC 1 cut(s) 807
SlaI CTCGAG 1 cut(s) 763
SmiMI CAYNNNNRTG 1 cut(s) 276
SmlI CTYRAG 3 cut(s) 122, 164, 763
SmoI CTYRAG 3 cut(s) 122, 164, 763
Sse9I AATT 6 cut(s) 7, 535, 562, 733, 849, 865
SseBI AGGCCT 1 cut(s) 725
SspMI CTAG 2 cut(s) 153, 485
StuI AGGCCT 1 cut(s) 725
StyD4I CCNGG 5 cut(s) 307, 393, 409, 637, 853
TaaI ACNGT 1 cut(s) 614
TaiI ACGT 2 cut(s) 294, 379
TaqI TCGA 2 cut(s) 764, 770
TasI AATT 6 cut(s) 7, 535, 562, 733, 849, 865
TatI WGTACW 1 cut(s) 792
TfiI GAWTC 1 cut(s) 81
Tru1I TTAA 1 cut(s) 474
Tru9I TTAA 1 cut(s) 474
TscAI CASTG 2 cut(s) 95, 809
TspDTI ATGAA 6 cut(s) 22, 41, 263, 536, 540, 671
TspRI CASTG 2 cut(s) 95, 809
Van91I CCANNNNNTGG 1 cut(s) 893
VpaK11BI GGWCC 1 cut(s) 807
XapI RAATTY 4 cut(s) 7, 535, 562, 865
XbaI TCTAGA 1 cut(s) 484
XceI RCATGY 1 cut(s) 700
XcmI CCANNNNNNNNNTGG 1 cut(s) 95
XhoI CTCGAG 1 cut(s) 763
XspI CTAG 2 cut(s) 153, 485
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.