Rmu_co8406615.1_g000001

Polygalacturonase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8406615.1
Physical Location & Seq
Reverse (-)
15 .. 395
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8406615.1_g000001.1.cds

Sequence Viewer

Length: 381 bp
atgactaagcttacaagttattttgccacagtgatattcatttttatacatattctatgccaatcatctgcttcaggtgatgggacgactacaagtacttataatgttttggagtttggagctaagaccaacggtgtaaccgattcaacccaagcttttctcaatgcttggttagtagcctgtggttcctccgcagattccaccgagatatatgtaccaaaggggaggtatttgctcggcgctatggcctttaaaggcgactgcaaaagctcacacatcactttttggattgatggaacactcgtggctttacctgattaccgagtactaggccaagctaacaactggcatggttcagctttgaaggagttagcgggataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

13.53

Weight (kDa)

6.24

Isoelectric Point (pI)

29.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
AciI CCGC 2 cut(s) 192, 374
AcuI CTGAAG 1 cut(s) 57
AfaI GTAC 3 cut(s) 97, 216, 327
AgsI TTSAA 2 cut(s) 147, 364
AluBI AGCT 6 cut(s) 10, 122, 155, 270, 338, 359
AluI AGCT 6 cut(s) 10, 122, 155, 270, 338, 359
AoxI GGCC 2 cut(s) 246, 331
AspLEI GCGC 1 cut(s) 242
AsuHPI GGTGA 1 cut(s) 89
BauI CACGAG 1 cut(s) 302
BccI CCATC 2 cut(s) 74, 287
BfaI CTAG 1 cut(s) 329
BfoI RGCGCY 1 cut(s) 243
BmcAI AGTACT 2 cut(s) 97, 327
BmiI GGNNCC 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 350
BseNI ACTGG 1 cut(s) 350
BshFI GGCC 2 cut(s) 248, 333
BslFI GGGAC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 97
BsnI GGCC 2 cut(s) 248, 333
BspACI CCGC 2 cut(s) 192, 374
BspANI GGCC 2 cut(s) 248, 333
BspLI GGNNCC 1 cut(s) 187
BsrI ACTGG 1 cut(s) 350
BssSI CACGAG 1 cut(s) 302
Bst2BI CACGAG 1 cut(s) 302
Bst4CI ACNGT 2 cut(s) 31, 134
BstDEI CTNAG 2 cut(s) 6, 123
BstH2I RGCGCY 1 cut(s) 243
BstHHI GCGC 1 cut(s) 242
BsuRI GGCC 2 cut(s) 248, 333
BtsIMutI CAGTG 1 cut(s) 36
CfoI GCGC 1 cut(s) 242
Csp6I GTAC 3 cut(s) 96, 215, 326
CviAII CATG 1 cut(s) 350
CviQI GTAC 3 cut(s) 96, 215, 326
DdeI CTNAG 2 cut(s) 6, 123
DraI TTTAAA 1 cut(s) 253
Eco57I CTGAAG 1 cut(s) 57
FaeI CATG 1 cut(s) 353
FaiI YATR 8 cut(s) 47, 51, 58, 102, 211, 213, 245, 351
FaqI GGGAC 1 cut(s) 97
FatI CATG 1 cut(s) 349
FauI CCCGC 1 cut(s) 367
FspBI CTAG 1 cut(s) 329
GlaI GCGC 1 cut(s) 241
HaeII RGCGCY 1 cut(s) 243
HaeIII GGCC 2 cut(s) 248, 333
HhaI GCGC 1 cut(s) 242
Hin1II CATG 1 cut(s) 353
Hin6I GCGC 1 cut(s) 240
HinP1I GCGC 1 cut(s) 240
HindIII AAGCTT 2 cut(s) 8, 153
HinfI GANTC 2 cut(s) 143, 197
HphI GGTGA 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 358
HpyCH4III ACNGT 2 cut(s) 31, 134
HpyCH4V TGCA 1 cut(s) 264
HpyF3I CTNAG 2 cut(s) 6, 123
Hsp92II CATG 1 cut(s) 353
HspAI GCGC 1 cut(s) 240
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 4 cut(s) 60, 193, 327, 331
MaeI CTAG 1 cut(s) 329
MaeIII GTNAC 1 cut(s) 136
MnlI CCTC 2 cut(s) 199, 219
MseI TTAA 1 cut(s) 252
NlaIII CATG 1 cut(s) 353
NlaIV GGNNCC 1 cut(s) 187
NmeAIII GCCGAG 1 cut(s) 216
PcsI WCGNNNNNNNCGW 1 cut(s) 138
PfeI GAWTC 2 cut(s) 143, 197
PsiI TTATAA 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 187
RsaI GTAC 3 cut(s) 97, 216, 327
RsaNI GTAC 3 cut(s) 96, 215, 326
SaqAI TTAA 1 cut(s) 252
ScaI AGTACT 2 cut(s) 97, 327
SetI ASST 9 cut(s) 12, 79, 124, 157, 230, 272, 316, 340, 361
SsiI CCGC 2 cut(s) 192, 374
SspMI CTAG 1 cut(s) 329
TaaI ACNGT 2 cut(s) 31, 134
TatI WGTACW 2 cut(s) 95, 325
TfiI GAWTC 2 cut(s) 143, 197
Tru1I TTAA 1 cut(s) 252
Tru9I TTAA 1 cut(s) 252
TscAI CASTG 1 cut(s) 36
TspDTI ATGAA 1 cut(s) 28
TspRI CASTG 1 cut(s) 36
XspI CTAG 1 cut(s) 329
ZrmI AGTACT 2 cut(s) 97, 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.