Rmu_sc0001250.1_g000034

LURP-one-related

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001250.1
Physical Location & Seq
Reverse (-)
152445 .. 153053
609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001250.1_g000034.1.cds

Sequence Viewer

Length: 609 bp
atggccagagttcatccaattctagtagtacccaggattgataatgcttctgttagtacctctccatgttttgaaccatacatgacctcaaggagagaaacattcactatatggatgaagtcccttgttatgcaaggaaatggatgcacagcgtatgacgaaaatggtgagattgtgtatcgtgttgataactacgacaacaagcacagcaatgaagtctatctcatggatctccgtggcaaagttctgtttactctatgtgagcagaaaatgtgcgttttcagacctaattgggaggcttatgagtccaatgggtcggacacgccattttttcgagtcagaaagagcaaaattttcggaggagagtcttcttataaggtaaccatgccatctgatggaagttgttacattttagaagctggtgggaaatcaacatttagaataagagatggcaatggaggagttgtagccgaggcaaagagaaagcaatcgtcttcaggggtagaattcggagatgatgtactgagtttagtggtggagcctcatgtggatcactccttcatcatggctcttgttactgtttatggcttaatcaaacgtcaaatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

202

Amino Acids

22.75

Weight (kDa)

6.9

Isoelectric Point (pI)

40.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 375
AccB7I CCANNNNNTGG 1 cut(s) 395
AclWI GGATC 2 cut(s) 237, 558
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 351, 506
AcuI CTGAAG 1 cut(s) 480
AfaI GTAC 3 cut(s) 30, 58, 522
AfiI CCNNNNNNNGG 1 cut(s) 395
AgsI TTSAA 1 cut(s) 74
AjnI CCWGG 1 cut(s) 32
AluBI AGCT 1 cut(s) 419
AluI AGCT 1 cut(s) 419
AlwI GGATC 2 cut(s) 237, 558
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 351, 506
AsuHPI GGTGA 1 cut(s) 179
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 2 cut(s) 360, 486
BccI CCATC 3 cut(s) 389, 397, 443
BcgI CGANNNNNNTGC 2 cut(s) 337, 371
BciT130I CCWGG 1 cut(s) 34
BfaI CTAG 1 cut(s) 23
Bme1390I CCNGG 1 cut(s) 34
BmiI GGNNCC 1 cut(s) 540
BmrFI CCNGG 1 cut(s) 34
BmsI GCATC 1 cut(s) 134
BpiI GAAGAC 2 cut(s) 360, 486
BpuEI CTTGAG 1 cut(s) 73
BsaJI CCNNGG 3 cut(s) 32, 235, 471
BsaXI ACNNNNNCTCC 4 cut(s) 450, 480, 504, 534
Bsc4I CCNNNNNNNGG 1 cut(s) 395
Bse3DI GCAATG 2 cut(s) 217, 460
BseBI CCWGG 1 cut(s) 34
BseDI CCNNGG 3 cut(s) 32, 235, 471
BseGI GGATG 3 cut(s) 13, 120, 149
BseLI CCNNNNNNNGG 1 cut(s) 395
BseMI GCAATG 2 cut(s) 217, 460
BseMII CTCAG 1 cut(s) 515
BseRI GAGGAG 2 cut(s) 375, 474
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 1 cut(s) 106
BslI CCNNNNNNNGG 1 cut(s) 395
BsmFI GGGAC 1 cut(s) 106
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 229, 550
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 516
BspLI GGNNCC 1 cut(s) 540
BspPI GGATC 2 cut(s) 237, 558
BsrDI GCAATG 2 cut(s) 217, 460
BssECI CCNNGG 3 cut(s) 32, 235, 471
BssMI GATC 2 cut(s) 229, 550
Bst2UI CCWGG 1 cut(s) 34
Bst4CI ACNGT 1 cut(s) 580
BstDEI CTNAG 1 cut(s) 524
BstDSI CCRYGG 1 cut(s) 235
BstEII GGTNACC 1 cut(s) 379
BstF5I GGATG 3 cut(s) 13, 120, 149
BstKTI GATC 2 cut(s) 232, 553
BstMBI GATC 2 cut(s) 229, 550
BstNI CCWGG 1 cut(s) 34
BstPI GGTNACC 1 cut(s) 379
BstSCI CCNGG 1 cut(s) 32
BstV2I GAAGAC 2 cut(s) 360, 486
BstX2I RGATCY 1 cut(s) 229
BstYI RGATCY 1 cut(s) 229
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 235
BtsCI GGATG 3 cut(s) 13, 120, 149
Csp6I GTAC 3 cut(s) 29, 57, 521
CviAII CATG 6 cut(s) 66, 82, 226, 385, 545, 565
CviJI RGCY 7 cut(s) 5, 299, 419, 470, 541, 569, 588
CviKI_1 RGCY 7 cut(s) 5, 299, 419, 470, 541, 569, 588
CviQI GTAC 3 cut(s) 29, 57, 521
DdeI CTNAG 1 cut(s) 524
DpnI GATC 2 cut(s) 231, 552
DpnII GATC 2 cut(s) 229, 550
EaeI YGGCCR 1 cut(s) 3
Eco57I CTGAAG 1 cut(s) 480
Eco91I GGTNACC 1 cut(s) 379
EcoO65I GGTNACC 1 cut(s) 379
EcoRI GAATTC 1 cut(s) 506
EcoRII CCWGG 1 cut(s) 32
FaeI CATG 6 cut(s) 69, 85, 229, 388, 548, 568
FaqI GGGAC 1 cut(s) 106
FatI CATG 6 cut(s) 65, 81, 225, 384, 544, 564
FokI GGATG 2 cut(s) 127, 156
FspBI CTAG 1 cut(s) 23
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 6 cut(s) 69, 85, 229, 388, 548, 568
HinfI GANTC 3 cut(s) 305, 336, 365
HphI GGTGA 1 cut(s) 179
Hpy166II GTNNAC 1 cut(s) 252
Hpy188I TCNGA 6 cut(s) 284, 319, 341, 359, 394, 512
Hpy8I GTNNAC 1 cut(s) 252
HpyAV CCTTC 1 cut(s) 568
HpyCH4III ACNGT 1 cut(s) 580
HpyCH4IV ACGT 1 cut(s) 598
HpyCH4V TGCA 2 cut(s) 133, 147
HpyF3I CTNAG 1 cut(s) 524
HpySE526I ACGT 1 cut(s) 598
Hsp92II CATG 6 cut(s) 69, 85, 229, 388, 548, 568
Kzo9I GATC 2 cut(s) 229, 550
LmnI GCTCC 1 cut(s) 538
LpnPI CCDG 5 cut(s) 19, 19, 46, 405, 483
LweI GCATC 1 cut(s) 134
MaeI CTAG 1 cut(s) 23
MaeII ACGT 1 cut(s) 598
MaeIII GTNAC 3 cut(s) 379, 404, 574
MalI GATC 2 cut(s) 231, 552
MboI GATC 2 cut(s) 229, 550
MboII GAAGA 2 cut(s) 360, 486
MflI RGATCY 1 cut(s) 229
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 4 cut(s) 18, 289, 351, 506
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 3 cut(s) 314, 345, 374
MmeI TCCRAC 1 cut(s) 297
MnlI CCTC 7 cut(s) 70, 97, 289, 353, 452, 466, 552
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 590
MslI CAYNNNNRTG 1 cut(s) 210
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 34
MvaI CCWGG 1 cut(s) 34
NdeII GATC 2 cut(s) 229, 550
NlaIII CATG 6 cut(s) 69, 85, 229, 388, 548, 568
NlaIV GGNNCC 1 cut(s) 540
NmeAIII GCCGAG 1 cut(s) 496
PflMI CCANNNNNTGG 1 cut(s) 395
PleI GAGTC 3 cut(s) 313, 344, 373
PpsI GAGTC 3 cut(s) 313, 344, 373
PsiI TTATAA 1 cut(s) 375
Psp6I CCWGG 1 cut(s) 32
PspEI GGTNACC 1 cut(s) 379
PspGI CCWGG 1 cut(s) 32
PspN4I GGNNCC 1 cut(s) 540
PsuI RGATCY 1 cut(s) 229
RsaI GTAC 3 cut(s) 30, 58, 522
RsaNI GTAC 3 cut(s) 29, 57, 521
RseI CAYNNNNRTG 1 cut(s) 210
SaqAI TTAA 1 cut(s) 590
Sau3AI GATC 2 cut(s) 229, 550
SchI GAGTC 3 cut(s) 314, 345, 374
ScrFI CCNGG 1 cut(s) 34
SetI ASST 6 cut(s) 62, 89, 289, 381, 421, 601
SfaNI GCATC 1 cut(s) 134
SmiMI CAYNNNNRTG 1 cut(s) 210
SmlI CTYRAG 1 cut(s) 88
SmoI CTYRAG 1 cut(s) 88
Sse9I AATT 4 cut(s) 18, 289, 351, 506
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 32
TaaI ACNGT 1 cut(s) 580
TaiI ACGT 1 cut(s) 601
TaqI TCGA 1 cut(s) 334
TasI AATT 4 cut(s) 18, 289, 351, 506
TatI WGTACW 1 cut(s) 520
Tru1I TTAA 1 cut(s) 590
Tru9I TTAA 1 cut(s) 590
TspDTI ATGAA 3 cut(s) 131, 228, 550
TspGWI ACGGA 1 cut(s) 224
Van91I CCANNNNNTGG 1 cut(s) 395
XapI RAATTY 2 cut(s) 351, 506
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.