Rmu_sc0006087.1_g000005

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006087.1
Physical Location & Seq
Forward (+)
18546 .. 19867
1322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006087.1_g000005.1.cds

Sequence Viewer

Length: 948 bp
atgagtggaacaaatgaagaaggtatccggttttcagatgtctttaatgaagcaaacgaatttatcctgtatcgatatgttgatttcttctggaagatcaagcggttcttaaacattggttccgaagcagtgctaaagaatcatatcaaagtgattgatcaatttatgtataaattaatcaaaagcaagatggatgctgtccgtaagtcagaagataggctacctctaaagaaaagagactttatttcaaggcttttggaaatgaaagagaccaatccaaagtatattaaagacatgggggtcaattttattattgccgggaaagacactgtggctactactctttcttggcttttttatatgctctgcaagtatcctcgtatacaagaaaagattgcacaggaggttagagaagcaaccaatctgaaagataatacaagtgtggatgagcttgcagccagccttactgaagaagtcctcgacaaaatgcaatatctccatgcagctttgactgagacactcagactgtaccctgcagttccagtgaatgcaaaagtctgtttttccgatgatacctggccagatggattcagtgtcaagaaaggggatatggtagcataccaaccttacgccatgggcaggatgaagtttctatggggtgatgatgcagaagagtttcgaccagagagatggctcgacgaaaatgacattttccagccagaaagccctttcaaattcacagtcttccaggctggtcccagaatttgcttaggaaaagaatttgcttataaggagatgaagatcttttctgctgtgcttttaggaaactacatattcaagctgagcgaaaagaaaacaggggtcaattacaggaccatgatcaacctccatattgatgggggaattttagtgcttgcctctccaagattggagcttgaaagatcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

315

Amino Acids

36.65

Weight (kDa)

7.61

Isoelectric Point (pI)

34.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000239)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g12320 FvH4_7g28340 FvH4_7g28350 FvH4_7g28350 FvH4_7g28361 FvH4_7g28450 FvH4_7g28450 FvH4_7g28452 FvH4_7g28453 FvH4_7g28453 FvH4_7g28454 FvH4_7g28455 FvH4_7g28458
malus_domestica MD01G1188000.v1.1 MD01G1188200.v1.1 MD02G1199800.v1.1 MD07G1191000.v1.1 MD11G1075700.v1.1 MD12G1092600.v1.1
prunus_persica Prupe.2G148800_v2.0.a1 Prupe.2G284500_v2.0.a1 Prupe.2G284800_v2.0.a1 Prupe.2G285200_v2.0.a1 Prupe.2G285200_v2.0.a1 Prupe.2G285200_v2.0.a1 Prupe.2G285200_v2.0.a1
pyrus_communis pycom02g16380 pycom11g06340
rosa_chinensis RchiOBHm_Chr1g0351121 RchiOBHm_Chr1g0359881 RchiOBHm_Chr1g0359951 RchiOBHm_Chr1g0375301 RchiOBHm_Chr1g0375441 RchiOBHm_Chr1g0375471 RchiOBHm_Chr1g0375491 RchiOBHm_Chr1g0375521 RchiOBHm_Chr1g0375531 RchiOBHm_Chr1g0375571 RchiOBHm_Chr1g0375641 RchiOBHm_Chr1g0375681 RchiOBHm_Chr1g0375701 RchiOBHm_Chr1g0375721 RchiOBHm_Chr1g0375751 RchiOBHm_Chr1g0375811 RchiOBHm_Chr1g0375831 RchiOBHm_Chr2g0116601 RchiOBHm_Chr2g0143131
rosa_laevigata RLG00000018292 RLG00000026650 RLG00000026653 RLG00000026655 RLG00000026657 RLG00000026659 RLG00000026660 RLG00000026662 RLG00000026670 RLG00000027846 RLG00000028430
rosa_multiflora Rmu_co8068694.1_g000001 Rmu_co8138120.1_g000001 Rmu_co8293475.1_g000001 Rmu_sc0000487.1_g000028 Rmu_sc0000487.1_g000030 Rmu_sc0000487.1_g000031 Rmu_sc0000487.1_g000051 Rmu_sc0000554.1_g000038 Rmu_sc0001619.1_g000015 Rmu_sc0001644.1_g000001 Rmu_sc0001644.1_g000009 Rmu_sc0001644.1_g000012 Rmu_sc0001644.1_g000013 Rmu_sc0001644.1_g000020 Rmu_sc0001644.1_g000023 Rmu_sc0001644.1_g000031 Rmu_sc0001943.1_g000001 Rmu_sc0001943.1_g000005 Rmu_sc0006087.1_g000005 Rmu_sc0008800.1_g000004 Rmu_sc0015155.1_g000001 Rmu_ssc0000106.1_g000005 Rmu_ssc0000368.1_g000003
rosa_roxburghii Rroxscaffold_2G00102100 Rroxscaffold_2G00127030 Rroxscaffold_4G00282580 Rroxscaffold_4G00282620 Rroxscaffold_4G00282650 Rroxscaffold_4G00282670 Rroxscaffold_4G00282740 Rroxscaffold_4G00282840 Rroxscaffold_4G00304050
rosa_rugosa Rorug01G0216600 Rorug01G0273300 Rorug01G0273400 Rorug01G0390900 Rorug01G0391000 Rorug01G0391400 Rorug01G0391500 Rorug01G0391600 Rorug01G0391700 Rorug01G0391800 Rorug02G0061300 Rorug02G0207800 Rorug02G0378000 Rorug02G0378100 Rorug02G0378200 Rorug02G0378300 Rorug02G0378300 Rorug02G0378300 Rorug03G0168600 Rorug06G0412800 Rorug06G0412900 Rorug06G0413000
rosa_samantha Rh1AG231000 Rh1AG287500 Rh1AG402800 Rh1CG379000 Rh2BG440100 Rh2CG417400 Rh2DG271100
rosa_wichuraiana Rw0G023590 Rw0G023600 Rw1G020080 Rw1G025530 Rw1G025540 Rw1G035580 Rw1G035650 Rw1G035670 Rw1G035690 Rw1G035700 Rw1G035740 Rw1G035760 Rw1G035780 Rw1G035800 Rw2G020700 Rw2G035250 Rw4G005840 Rw4G005850 Rw4G005860 Rw4G005890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 789
AasI GACNNNNNNGTC 1 cut(s) 299
AccI GTMKAC 1 cut(s) 382
AciI CCGC 1 cut(s) 103
AcoI YGGCCR 1 cut(s) 578
AcsI RAATTY 5 cut(s) 59, 734, 762, 779, 903
AcuI CTGAAG 1 cut(s) 489
AfaI GTAC 1 cut(s) 530
AfiI CCNNNNNNNGG 1 cut(s) 639
AgsI TTSAA 4 cut(s) 249, 733, 838, 938
AjnI CCWGG 2 cut(s) 575, 747
AluBI AGCT 4 cut(s) 451, 506, 841, 934
AluI AGCT 4 cut(s) 451, 506, 841, 934
Alw26I GTCTC 3 cut(s) 231, 263, 509
AoxI GGCC 1 cut(s) 578
ApeKI GCWGC 2 cut(s) 455, 503
ApoI RAATTY 5 cut(s) 59, 734, 762, 779, 903
ArsI GACNNNNNNTTYG 2 cut(s) 726, 758
AseI ATTAAT 1 cut(s) 176
Asp700I GAANNNNTTC 1 cut(s) 675
AspS9I GGNCC 2 cut(s) 755, 873
AsuC2I CCSGG 1 cut(s) 319
AsuHPI GGTGA 1 cut(s) 671
AvaII GGWCC 2 cut(s) 755, 873
BalI TGGCCA 1 cut(s) 580
BarI GAAGNNNNNNTAC 2 cut(s) 204, 236
BbsI GAAGAC 1 cut(s) 736
BbvI GCAGC 2 cut(s) 467, 515
BccI CCATC 4 cut(s) 184, 578, 684, 890
BciT130I CCWGG 2 cut(s) 577, 749
BciVI GTATCC 2 cut(s) 35, 384
BclI TGATCA 2 cut(s) 157, 879
BcnI CCSGG 1 cut(s) 319
BcoDI GTCTC 3 cut(s) 231, 263, 509
BfmI CTRYAG 1 cut(s) 534
BfuI GTATCC 2 cut(s) 35, 384
BglII AGATCT 2 cut(s) 801, 941
BisI GCNGC 2 cut(s) 456, 504
BlpI GCTNAGC 1 cut(s) 842
BlsI GCNGC 2 cut(s) 457, 505
Bme1390I CCNGG 3 cut(s) 319, 577, 749
Bme18I GGWCC 2 cut(s) 755, 873
BmgT120I GGNCC 2 cut(s) 755, 873
BmiI GGNNCC 2 cut(s) 121, 757
BmrFI CCNGG 3 cut(s) 319, 577, 749
BmsI GCATC 2 cut(s) 184, 655
BpiI GAAGAC 1 cut(s) 736
Bpu10I CCTNAGC 1 cut(s) 769
Bpu1102I GCTNAGC 1 cut(s) 842
BpuMI CCSGG 1 cut(s) 319
Bsa29I ATCGAT 1 cut(s) 73
BsaBI GATNNNNATC 1 cut(s) 800
BsaI GGTCTC 1 cut(s) 263
BsaJI CCNNGG 1 cut(s) 633
BsaWI WCCGGW 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 639
Bse1I ACTGG 1 cut(s) 542
Bse8I GATNNNNATC 1 cut(s) 800
BseBI CCWGG 2 cut(s) 577, 749
BseCI ATCGAT 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 633
BseGI GGATG 3 cut(s) 199, 451, 648
BseJI GATNNNNATC 1 cut(s) 800
BseLI CCNNNNNNNGG 1 cut(s) 639
BseMII CTCAG 3 cut(s) 504, 535, 833
BseNI ACTGG 1 cut(s) 542
BseXI GCAGC 2 cut(s) 467, 515
BshFI GGCC 1 cut(s) 580
BshVI ATCGAT 1 cut(s) 73
BsiSI CCGG 2 cut(s) 28, 318
BslFI GGGAC 1 cut(s) 741
BslI CCNNNNNNNGG 1 cut(s) 639
BsmAI GTCTC 3 cut(s) 231, 263, 509
BsmFI GGGAC 1 cut(s) 741
BsmI GAATGC 1 cut(s) 553
BsnI GGCC 1 cut(s) 580
Bso31I GGTCTC 1 cut(s) 263
Bsp143I GATC 5 cut(s) 96, 157, 801, 879, 941
Bsp1720I GCTNAGC 1 cut(s) 842
Bsp19I CCATGG 1 cut(s) 633
BspACI CCGC 1 cut(s) 103
BspANI GGCC 1 cut(s) 580
BspCNI CTCAG 3 cut(s) 505, 534, 834
BspDI ATCGAT 1 cut(s) 73
BspLI GGNNCC 2 cut(s) 121, 757
BspMAI CTGCAG 1 cut(s) 538
BspTNI GGTCTC 1 cut(s) 263
BsrI ACTGG 1 cut(s) 542
BssECI CCNNGG 1 cut(s) 633
BssMI GATC 5 cut(s) 96, 157, 801, 879, 941
BssNAI GTATAC 1 cut(s) 383
BssT1I CCWWGG 1 cut(s) 633
Bst1107I GTATAC 1 cut(s) 383
Bst2UI CCWGG 2 cut(s) 577, 749
Bst4CI ACNGT 3 cut(s) 331, 528, 742
Bst6I CTCTTC 1 cut(s) 666
BstC8I GCNNGC 3 cut(s) 453, 460, 915
BstDEI CTNAG 5 cut(s) 513, 521, 769, 842, 945
BstDSI CCRYGG 1 cut(s) 633
BstF5I GGATG 3 cut(s) 199, 451, 648
BstKTI GATC 5 cut(s) 99, 160, 804, 882, 944
BstMAI GTCTC 3 cut(s) 231, 263, 509
BstMBI GATC 5 cut(s) 96, 157, 801, 879, 941
BstNI CCWGG 2 cut(s) 577, 749
BstSCI CCNGG 3 cut(s) 317, 575, 747
BstSFI CTRYAG 1 cut(s) 534
BstV1I GCAGC 2 cut(s) 467, 515
BstV2I GAAGAC 1 cut(s) 736
BstX2I RGATCY 2 cut(s) 801, 941
BstXI CCANNNNNNTGG 2 cut(s) 690, 896
BstYI RGATCY 2 cut(s) 801, 941
BstZ17I GTATAC 1 cut(s) 383
Bsu15I ATCGAT 1 cut(s) 73
BsuI GTATCC 2 cut(s) 35, 384
BsuRI GGCC 1 cut(s) 580
BsuTUI ATCGAT 1 cut(s) 73
BtgI CCRYGG 1 cut(s) 633
BtsCI GGATG 3 cut(s) 199, 451, 648
BtsI GCAGTG 1 cut(s) 135
BtsIMutI CAGTG 4 cut(s) 135, 327, 549, 598
Cac8I GCNNGC 3 cut(s) 453, 460, 915
Cfr13I GGNCC 2 cut(s) 755, 873
ClaI ATCGAT 1 cut(s) 73
Csp6I GTAC 1 cut(s) 529
CviAII CATG 4 cut(s) 295, 500, 634, 877
CviQI GTAC 1 cut(s) 529
DdeI CTNAG 5 cut(s) 513, 521, 769, 842, 945
DpnI GATC 5 cut(s) 98, 159, 803, 881, 943
DpnII GATC 5 cut(s) 96, 157, 801, 879, 941
DrdI GACNNNNNNGTC 1 cut(s) 299
DseDI GACNNNNNNGTC 1 cut(s) 299
EaeI YGGCCR 1 cut(s) 578
Eam1104I CTCTTC 1 cut(s) 666
EarI CTCTTC 1 cut(s) 666
Eco130I CCWWGG 1 cut(s) 633
Eco31I GGTCTC 1 cut(s) 263
Eco47I GGWCC 2 cut(s) 755, 873
Eco57I CTGAAG 1 cut(s) 489
EcoRII CCWGG 2 cut(s) 575, 747
EcoT14I CCWWGG 1 cut(s) 633
ErhI CCWWGG 1 cut(s) 633
FaeI CATG 4 cut(s) 298, 503, 637, 880
FalI AAGNNNNNCTT 2 cut(s) 92, 124
FaqI GGGAC 1 cut(s) 741
FatI CATG 4 cut(s) 294, 499, 633, 876
FbaI TGATCA 2 cut(s) 157, 879
FblI GTMKAC 1 cut(s) 382
Fnu4HI GCNGC 2 cut(s) 456, 504
FokI GGATG 3 cut(s) 206, 458, 655
Fsp4HI GCNGC 2 cut(s) 456, 504
GluI GCNGC 2 cut(s) 456, 504
HaeIII GGCC 1 cut(s) 580
HapII CCGG 2 cut(s) 28, 318
Hin1II CATG 4 cut(s) 298, 503, 637, 880
HinfI GANTC 2 cut(s) 139, 588
HpaII CCGG 2 cut(s) 28, 318
HphI GGTGA 1 cut(s) 671
Hpy166II GTNNAC 1 cut(s) 383
Hpy188I TCNGA 6 cut(s) 37, 124, 211, 426, 524, 568
Hpy188III TCNNGA 2 cut(s) 91, 598
Hpy8I GTNNAC 1 cut(s) 383
Hpy99I CGWCG 1 cut(s) 701
HpyAV CCTTC 1 cut(s) 14
HpyCH4III ACNGT 3 cut(s) 331, 528, 742
HpyCH4V TGCA 8 cut(s) 369, 398, 455, 490, 503, 536, 551, 668
HpyF3I CTNAG 5 cut(s) 513, 521, 769, 842, 945
Hsp92II CATG 4 cut(s) 298, 503, 637, 880
Ksp22I TGATCA 2 cut(s) 157, 879
Kzo9I GATC 5 cut(s) 96, 157, 801, 879, 941
LmnI GCTCC 1 cut(s) 931
Lsp1109I GCAGC 2 cut(s) 467, 515
LweI GCATC 2 cut(s) 184, 655
MalI GATC 5 cut(s) 98, 159, 803, 881, 943
MboI GATC 5 cut(s) 96, 157, 801, 879, 941
MboII GAAGA 8 cut(s) 29, 79, 106, 224, 482, 683, 736, 811
MflI RGATCY 2 cut(s) 801, 941
MlsI TGGCCA 1 cut(s) 580
MluCI AATT 9 cut(s) 59, 161, 173, 304, 734, 762, 779, 865, 903
MluNI TGGCCA 1 cut(s) 580
MnlI CCTC 6 cut(s) 234, 387, 397, 488, 896, 928
Mox20I TGGCCA 1 cut(s) 580
MroXI GAANNNNTTC 1 cut(s) 675
MscI TGGCCA 1 cut(s) 580
MseI TTAA 4 cut(s) 45, 110, 176, 288
MslI CAYNNNNRTG 1 cut(s) 894
Msp20I TGGCCA 1 cut(s) 580
MspI CCGG 2 cut(s) 28, 318
MspR9I CCNGG 3 cut(s) 319, 577, 749
Mva1269I GAATGC 1 cut(s) 553
MvaI CCWGG 2 cut(s) 577, 749
NciI CCSGG 1 cut(s) 319
NcoI CCATGG 1 cut(s) 633
NdeII GATC 5 cut(s) 96, 157, 801, 879, 941
NlaIII CATG 4 cut(s) 298, 503, 637, 880
NlaIV GGNNCC 2 cut(s) 121, 757
PctI GAATGC 1 cut(s) 553
PdmI GAANNNNTTC 1 cut(s) 675
PfeI GAWTC 2 cut(s) 139, 588
PkrI GCNGC 2 cut(s) 457, 505
PshBI ATTAAT 1 cut(s) 176
PsiI TTATAA 1 cut(s) 789
Psp6I CCWGG 2 cut(s) 575, 747
PspGI CCWGG 2 cut(s) 575, 747
PspN4I GGNNCC 2 cut(s) 121, 757
PspPI GGNCC 2 cut(s) 755, 873
PstI CTGCAG 1 cut(s) 538
PsuI RGATCY 2 cut(s) 801, 941
RsaI GTAC 1 cut(s) 530
RsaNI GTAC 1 cut(s) 529
RseI CAYNNNNRTG 1 cut(s) 894
SaqAI TTAA 4 cut(s) 45, 110, 176, 288
SatI GCNGC 2 cut(s) 456, 504
Sau3AI GATC 5 cut(s) 96, 157, 801, 879, 941
Sau96I GGNCC 2 cut(s) 755, 873
ScrFI CCNGG 3 cut(s) 319, 577, 749
SfaNI GCATC 2 cut(s) 184, 655
SfcI CTRYAG 1 cut(s) 534
SinI GGWCC 2 cut(s) 755, 873
SmiMI CAYNNNNRTG 1 cut(s) 894
Sse9I AATT 9 cut(s) 59, 161, 173, 304, 734, 762, 779, 865, 903
SsiI CCGC 1 cut(s) 103
StyD4I CCNGG 3 cut(s) 317, 575, 747
StyI CCWWGG 1 cut(s) 633
TaaI ACNGT 3 cut(s) 331, 528, 742
TaqI TCGA 4 cut(s) 73, 480, 679, 696
TasI AATT 9 cut(s) 59, 161, 173, 304, 734, 762, 779, 865, 903
TfiI GAWTC 2 cut(s) 139, 588
Tru1I TTAA 4 cut(s) 45, 110, 176, 288
Tru9I TTAA 4 cut(s) 45, 110, 176, 288
TscAI CASTG 4 cut(s) 135, 334, 549, 598
TseI GCWGC 2 cut(s) 455, 503
TspDTI ATGAA 5 cut(s) 30, 63, 278, 659, 812
TspGWI ACGGA 1 cut(s) 191
TspRI CASTG 4 cut(s) 135, 334, 549, 598
VpaK11BI GGWCC 2 cut(s) 755, 873
VspI ATTAAT 1 cut(s) 176
XapI RAATTY 5 cut(s) 59, 734, 762, 779, 903
XmiI GTMKAC 1 cut(s) 382
XmnI GAANNNNTTC 1 cut(s) 675
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.