Rmu_sc0007965.1_g000003

CAAX prenyl protease 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007965.1
Physical Location & Seq
Reverse (-)
20033 .. 21434
1402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007965.1_g000003.1.cds

Sequence Viewer

Length: 597 bp
atgcttgtttactctcttgtgatgatgaccatctaccctattctaatagccccactctttaacaagttcacccctcttccggagggtcagctcagggaaaaaattgagaagctctgttcttcccttgattttccattgaagaagctgtttgtcattgatggatcaacaagatcaacttacagcaattgcaaaaatgatgaggaagttgtagctgttcaagctcatgagctaggccattggaagcttaatcacacaatccgtatgcttttaaaatttggtggatatgctctcctgagaaactccagcagtctgtttcaaagttttgggtttgatactcaaccacataccattacacctatccagcacctagtacgctttgctagtaaccttgtgagccgagcttttgaatttcaggctgatgattttgctaagaaacttggttatgcctcttcacttcgagccagtctagtgaggctgcaggaagagaatttgtcagctatgaacatcaatccatggtacttggcatatcaccgttctcatcccccacttgttcaaaggttggctgcaattggtgatgtggacaagaaagcagactga

Protein Analysis

198

Amino Acids

22.53

Weight (kDa)

9.06

Isoelectric Point (pI)

37.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 79
AclWI GGATC 1 cut(s) 169
AcsI RAATTY 3 cut(s) 272, 407, 487
AfaI GTAC 2 cut(s) 372, 518
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 5 cut(s) 139, 218, 317, 407, 554
AluBI AGCT 9 cut(s) 91, 112, 145, 212, 221, 229, 244, 401, 497
AluI AGCT 9 cut(s) 91, 112, 145, 212, 221, 229, 244, 401, 497
AlwI GGATC 1 cut(s) 169
Aor13HI TCCGGA 1 cut(s) 79
AoxI GGCC 1 cut(s) 232
ApeKI GCWGC 2 cut(s) 475, 563
ApoI RAATTY 3 cut(s) 272, 407, 487
AsuHPI GGTGA 3 cut(s) 61, 521, 584
BbvI GCAGC 2 cut(s) 462, 550
BccI CCATC 2 cut(s) 38, 152
BfaI CTAG 4 cut(s) 230, 368, 381, 467
BfmI CTRYAG 1 cut(s) 476
BisI GCNGC 2 cut(s) 476, 564
BlsI GCNGC 2 cut(s) 477, 565
BpmI CTGGAG 1 cut(s) 286
Bpu10I CCTNAGC 1 cut(s) 92
BsaBI GATNNNNATC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 512
BsaWI WCCGGW 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse1I ACTGG 1 cut(s) 462
Bse8I GATNNNNATC 1 cut(s) 29
BseAI TCCGGA 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 512
BseGI GGATG 1 cut(s) 538
BseJI GATNNNNATC 1 cut(s) 29
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMII CTCAG 2 cut(s) 106, 284
BseNI ACTGG 1 cut(s) 462
BseXI GCAGC 2 cut(s) 462, 550
BshFI GGCC 1 cut(s) 234
BsiSI CCGG 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 79
BsnI GGCC 1 cut(s) 234
Bsp13I TCCGGA 1 cut(s) 79
Bsp143I GATC 2 cut(s) 161, 170
Bsp19I CCATGG 1 cut(s) 512
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 2 cut(s) 105, 285
BspEI TCCGGA 1 cut(s) 79
BspHI TCATGA 1 cut(s) 223
BspMAI CTGCAG 1 cut(s) 480
BspPI GGATC 1 cut(s) 169
BsrI ACTGG 1 cut(s) 462
BssECI CCNNGG 1 cut(s) 512
BssMI GATC 2 cut(s) 161, 170
BssT1I CCWWGG 1 cut(s) 512
Bst4CI ACNGT 1 cut(s) 533
Bst6I CTCTTC 3 cut(s) 81, 454, 477
BstDEI CTNAG 3 cut(s) 92, 293, 429
BstDSI CCRYGG 1 cut(s) 512
BstF5I GGATG 1 cut(s) 538
BstKTI GATC 2 cut(s) 164, 173
BstMBI GATC 2 cut(s) 161, 170
BstMWI GCNNNNNNNGC 1 cut(s) 218
BstSFI CTRYAG 1 cut(s) 476
BstV1I GCAGC 2 cut(s) 462, 550
BsuRI GGCC 1 cut(s) 234
BtgI CCRYGG 1 cut(s) 512
BtsCI GGATG 1 cut(s) 538
CciI TCATGA 1 cut(s) 223
Csp6I GTAC 2 cut(s) 371, 517
CviAII CATG 2 cut(s) 224, 513
CviQI GTAC 2 cut(s) 371, 517
DdeI CTNAG 3 cut(s) 92, 293, 429
DpnI GATC 2 cut(s) 163, 172
DpnII GATC 2 cut(s) 161, 170
DraI TTTAAA 1 cut(s) 270
Eam1104I CTCTTC 3 cut(s) 81, 454, 477
EarI CTCTTC 3 cut(s) 81, 454, 477
Eco130I CCWWGG 1 cut(s) 512
EcoT14I CCWWGG 1 cut(s) 512
ErhI CCWWGG 1 cut(s) 512
FaeI CATG 2 cut(s) 227, 516
FaiI YATR 8 cut(s) 225, 263, 285, 345, 444, 500, 514, 526
FalI AAGNNNNNCTT 2 cut(s) 160, 192
FatI CATG 2 cut(s) 223, 512
Fnu4HI GCNGC 2 cut(s) 476, 564
FokI GGATG 1 cut(s) 525
Fsp4HI GCNGC 2 cut(s) 476, 564
FspBI CTAG 4 cut(s) 230, 368, 381, 467
GluI GCNGC 2 cut(s) 476, 564
GsuI CTGGAG 1 cut(s) 286
HaeIII GGCC 1 cut(s) 234
HapII CCGG 1 cut(s) 80
Hin1II CATG 2 cut(s) 227, 516
HindIII AAGCTT 1 cut(s) 242
HpaII CCGG 1 cut(s) 80
HphI GGTGA 3 cut(s) 61, 521, 584
Hpy166II GTNNAC 3 cut(s) 10, 69, 580
Hpy188III TCNNGA 3 cut(s) 80, 224, 292
Hpy8I GTNNAC 3 cut(s) 10, 69, 580
HpyCH4III ACNGT 1 cut(s) 533
HpyCH4V TGCA 3 cut(s) 189, 478, 566
HpyF10VI GCNNNNNNNGC 1 cut(s) 218
HpyF3I CTNAG 3 cut(s) 92, 293, 429
Hsp92II CATG 2 cut(s) 227, 516
Kpn2I TCCGGA 1 cut(s) 79
Kzo9I GATC 2 cut(s) 161, 170
LpnPI CCDG 8 cut(s) 79, 93, 305, 316, 374, 398, 464, 475
Lsp1109I GCAGC 2 cut(s) 462, 550
MaeI CTAG 4 cut(s) 230, 368, 381, 467
MaeIII GTNAC 1 cut(s) 383
MalI GATC 2 cut(s) 163, 172
MboI GATC 2 cut(s) 161, 170
MboII GAAGA 5 cut(s) 68, 111, 151, 441, 494
MfeI CAATTG 2 cut(s) 184, 567
MluCI AATT 6 cut(s) 102, 184, 272, 407, 487, 567
MnlI CCTC 5 cut(s) 76, 84, 193, 457, 465
MroI TCCGGA 1 cut(s) 79
MseI TTAA 3 cut(s) 60, 246, 269
MspI CCGG 1 cut(s) 80
MunI CAATTG 2 cut(s) 184, 567
MwoI GCNNNNNNNGC 1 cut(s) 218
NcoI CCATGG 1 cut(s) 512
NdeII GATC 2 cut(s) 161, 170
NlaIII CATG 2 cut(s) 227, 516
NmeAIII GCCGAG 1 cut(s) 422
PagI TCATGA 1 cut(s) 223
PkrI GCNGC 2 cut(s) 477, 565
PstI CTGCAG 1 cut(s) 480
RsaI GTAC 2 cut(s) 372, 518
RsaNI GTAC 2 cut(s) 371, 517
SaqAI TTAA 3 cut(s) 60, 246, 269
SatI GCNGC 2 cut(s) 476, 564
Sau3AI GATC 2 cut(s) 161, 170
SfcI CTRYAG 1 cut(s) 476
Sse9I AATT 6 cut(s) 102, 184, 272, 407, 487, 567
SspMI CTAG 4 cut(s) 230, 368, 381, 467
StyI CCWWGG 1 cut(s) 512
TaaI ACNGT 1 cut(s) 533
TaqI TCGA 1 cut(s) 457
TasI AATT 6 cut(s) 102, 184, 272, 407, 487, 567
Tru1I TTAA 3 cut(s) 60, 246, 269
Tru9I TTAA 3 cut(s) 60, 246, 269
TseI GCWGC 2 cut(s) 475, 563
TspDTI ATGAA 1 cut(s) 515
TspGWI ACGGA 1 cut(s) 248
XapI RAATTY 3 cut(s) 272, 407, 487
XspI CTAG 4 cut(s) 230, 368, 381, 467
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.