Rorug01G0213800

CAAX prenyl protease 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
30431634 .. 30435314
3681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0213800.1

Sequence Viewer

Length: 231 bp
ATGGCATCATCGTCATCATCATCGAGTGCGTCAACACCTCCATACCCAAGCGCTGCTAGAATCTCTGATTCTCAATGTTATCAGCAGTACACTGCCTCTCTCAAATGTCTAGAAAAATATCACTCAGACAAGAGCAAATGTCAAGAACATTTTGATATTTATAAAGAATGCAAGAAAAAGGAGAGAGAAGCTCGATTGGAGCGAAACAAGAGTAGGTCTCTTTTCTCTTGA

Protein Analysis

76

Amino Acids

8.71

Weight (kDa)

9.14

Isoelectric Point (pI)

59.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CHCH PF06747 26 - 60 6.9e-08 CHCH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 162
AfaI GTAC 1 cut(s) 89
AfeI AGCGCT 1 cut(s) 52
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
Alw26I GTCTC 1 cut(s) 222
Aor51HI AGCGCT 1 cut(s) 52
ApeKI GCWGC 1 cut(s) 53
AspLEI GCGC 1 cut(s) 53
BbvI GCAGC 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 222
BfaI CTAG 2 cut(s) 57, 110
BfoI RGCGCY 1 cut(s) 54
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
BmsI GCATC 1 cut(s) 14
BplI GAGNNNNNCTC 3 cut(s) 175, 207, 202
BsaI GGTCTC 1 cut(s) 222
BseMII CTCAG 1 cut(s) 138
BseXI GCAGC 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 222
BsmI GAATGC 1 cut(s) 173
Bso31I GGTCTC 1 cut(s) 222
BspCNI CTCAG 1 cut(s) 137
BspTNI GGTCTC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 124
BstH2I RGCGCY 1 cut(s) 54
BstHHI GCGC 1 cut(s) 53
BstMAI GTCTC 1 cut(s) 222
BstV1I GCAGC 1 cut(s) 40
BtsI GCAGTG 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 90
CfoI GCGC 1 cut(s) 53
CseI GACGC 1 cut(s) 18
Csp6I GTAC 1 cut(s) 88
CviJI RGCY 1 cut(s) 191
CviKI_1 RGCY 1 cut(s) 191
CviQI GTAC 1 cut(s) 88
DdeI CTNAG 1 cut(s) 124
Eco31I GGTCTC 1 cut(s) 222
Eco47III AGCGCT 1 cut(s) 52
FaiI YATR 2 cut(s) 43, 162
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 2 cut(s) 57, 110
FspEI CC 8 cut(s) 51, 54, 59, 60, 109, 164, 182, 199
GlaI GCGC 1 cut(s) 52
GluI GCNGC 1 cut(s) 54
HaeII RGCGCY 1 cut(s) 54
HgaI GACGC 1 cut(s) 18
HhaI GCGC 1 cut(s) 53
Hin6I GCGC 1 cut(s) 51
HinP1I GCGC 1 cut(s) 51
HincII GTYRAC 1 cut(s) 33
HindII GTYRAC 1 cut(s) 33
HinfI GANTC 2 cut(s) 60, 68
Hpy166II GTNNAC 2 cut(s) 33, 90
Hpy188I TCNGA 2 cut(s) 67, 127
Hpy188III TCNNGA 3 cut(s) 110, 143, 228
Hpy8I GTNNAC 2 cut(s) 33, 90
HpyCH4V TGCA 1 cut(s) 171
HpyF3I CTNAG 1 cut(s) 124
HspAI GCGC 1 cut(s) 51
LmnI GCTCC 1 cut(s) 199
Lsp1109I GCAGC 1 cut(s) 40
LweI GCATC 1 cut(s) 14
MaeI CTAG 2 cut(s) 57, 110
MnlI CCTC 2 cut(s) 48, 106
Mva1269I GAATGC 1 cut(s) 173
PcsI WCGNNNNNNNCGW 1 cut(s) 199
PctI GAATGC 1 cut(s) 173
PfeI GAWTC 2 cut(s) 60, 68
PkrI GCNGC 1 cut(s) 55
PsiI TTATAA 1 cut(s) 162
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
SatI GCNGC 1 cut(s) 54
SetI ASST 3 cut(s) 40, 193, 218
SfaNI GCATC 1 cut(s) 14
SgeI CNNG 9 cut(s) 36, 60, 69, 122, 142, 155, 184, 204, 220
SspMI CTAG 2 cut(s) 57, 110
TaqI TCGA 2 cut(s) 23, 193
TatI WGTACW 1 cut(s) 87
TfiI GAWTC 2 cut(s) 60, 68
TscAI CASTG 1 cut(s) 97
TseI GCWGC 1 cut(s) 53
TspRI CASTG 1 cut(s) 97
XbaI TCTAGA 1 cut(s) 109
XspI CTAG 2 cut(s) 57, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.