Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000452.1

Orthogroup ID

OG0001051

Physical Location & Seq

Genomic Coordinates Reverse (-)

4950 .. 8791

Gene Structure 3842 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000452.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1518 bp

atgtcgactgtgtcgggaggtgagttgggagcgttgacgctgcgttggggtcacgtcggcttgtggtgttctgactaccagtgtagatctgggtcgtcagctttggctaacgttagcttatcaacgctagcagagcagcggttgatggggtggaagagaaggccgccagattccatggcggcgaggacgaggggatggcagaagggaaaggcttctgctcactctgctcagggttggccttggttcaatcttgggttgatgggctctatgttttggccttccgtgggaatcgaaatggaggtggtgcagatacttcacatgaacaaaggcaacggcgaggctagttatgcccaaaattccgaagttcagaacaaaatattagcaatcgcaaagccaatcactgagaaagccttgctcgaactgttggggtcaaaccgtgttatggcaatggagagtatgggcatagcggatttgggttgctcatctggacctaacaccttgcttctcatatcggagatcatggatgtcatacatgcccaactcagcagtggccagctgcatccctcgtcgtcgtcaatggagtttagagtgtttctcaacgacctatgcagcaacgacttcaacaccgtcttcatgacacttcccgcattctacaacaagctgagagaagacgatcgctacaagatattgtttggggctaaccccaacctcttcatttccgctgtgccgggctctttctacggcagattgtttgccagaaaaagcctgcacttcgtgcactcgtcctccagtcttcactggctctctcaggttcccccgagcctggacagcaagaccggcacggccttgaacaaggggaagatctacatttctaagagcagtccgcaatgcgtattggatgcgtactcacttcaattccacgaggactttttgatgtttctcaagtctcgggcagaagaaatggttggaggaggaagaatggtcttgtcattcatgggcaggccaacacttgaccctacaaccgaacagagttgctaccattgggaactcttggcccttgcattgatgagcatggtttcagatggtcttgtggaagaggagaaagttgattccttcaacgctccctactatgccccatgtgcagaggaactgaagtcggtgttgcaaaaggacgaatcattcataatggaccgacttgaagcgttcgaaattgattgggacggtggtggtgatgttgttgatgatcaaggtaatatcgttaatggttttgatcatgatcagatggtggctattagtgggaagcgggtggccaaaaccataagagcggtggtagagtcaatgatcgaagctcatttcgggatagaaattatggatgatctgtttcagagacgccggaatccggtcactagtccggtagctggattcaggtcaccggtcgccgaaatcagtcaccggagtccctggccggtcactagtcaccagagtccggcaaggttgatgacttctccaactaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006082 GO:0006950 GO:0008150 GO:0008152 GO:0008168 GO:0008757 GO:0009611 GO:0009694 GO:0009987 GO:0010817 GO:0016740 GO:0016741 GO:0019752 GO:0030795 GO:0032259 GO:0032787 GO:0042445 GO:0043436 GO:0044237 GO:0044281 GO:0044424 GO:0044464 GO:0050896 GO:0065007 GO:0065008 GO:0071704

KEGG Pathways

Metabolic & Signaling

ko00592 ko01110 map00592 map01110

Pfam Domains

Protein Families

Methyltransf_7

Protein Analysis

505

Amino Acids

55.88

Weight (kDa)

5.98

Isoelectric Point (pI)

53.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001051)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G19640
fragaria_vesca	FvH4_2g39441 FvH4_2g39441 FvH4_2g39450 FvH4_4g32530 FvH4_4g32530 FvH4_4g32530 FvH4_4g32960
malus_domestica	MD08G1027000.v1.1 MD08G1027100.v1.1 MD08G1027300.v1.1 MD15G1023600.v1.1 MD15G1023700.v1.1
prunus_persica	Prupe.1G375700_v2.0.a1 Prupe.1G375800_v2.0.a1
pyrus_communis	pycom08g02110 pycom15g01960 pycom15g01970 pycom15g02010
rosa_chinensis	RchiOBHm_Chr4g0441411 RchiOBHm_Chr6g0301501 RchiOBHm_Chr6g0301511 RchiOBHm_Chr6g0301521
rosa_laevigata	RLG00000006093 RLG00000006094 RLG00000011247 RLG00000011248
rosa_multiflora	Rmu_co8385149.1_g000001 Rmu_co8452201.1_g000002 Rmu_sc0004253.1_g000002 Rmu_sc0034371.1_g000001 Rmu_sc0038282.1_g000002 Rmu_ssc0000452.1_g000002
rosa_roxburghii	Rroxscaffold_3G00235790 Rroxscaffold_5G00382280 Rroxscaffold_7G00166690 Rroxscaffold_7G00166700
rosa_rugosa	Rorug04G0333100 Rorug04G0333300 Rorug04G0333400 Rorug06G0305400 Rorug06G0305500 Rorug06G0305600 Rorug06G0305700 Rorug07G0216800 Rorug07G0217000
rosa_samantha	Rh4AG385100 Rh4BG399100 Rh4BG399200 Rh4CG414200 Rh4CG414300 Rh4DG391800 Rh6AG419400 Rh6BG425300 Rh6CG432500 Rh6DG418500 Rh6DG418600 Rh7BG350600
rosa_wichuraiana	Rw4G033250 Rw6G036260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	1325
AccI	GTMKAC	1 cut(s)	5
AciI	CCGC	9 cut(s)	139, 164, 179, 467, 645, 720, 884, 1303, 1325
AclI	AACGTT	1 cut(s)	111
AcoI	YGGCCR	3 cut(s)	550, 1308, 1463
AcsI	RAATTY	1 cut(s)	355
AcuI	CTGAAG	1 cut(s)	1172
AcyI	GRCGYC	1 cut(s)	1390
AdeI	CACNNNGTG	1 cut(s)	775
AfaI	GTAC	1 cut(s)	905
AfiI	CCNNNNNNNGG	6 cut(s)	284, 442, 823, 1399, 1418, 1486
AgeI	ACCGGT	1 cut(s)	1432
AgsI	TTSAA	6 cut(s)	247, 622, 850, 914, 1117, 1199
AhlI	ACTAGT	2 cut(s)	1406, 1472
AjiI	CACGTC	1 cut(s)	55
AjnI	CCWGG	2 cut(s)	822, 1460
AjuI	GAANNNNNNNTTGG	2 cut(s)	948, 980
AluBI	AGCT	6 cut(s)	101, 117, 556, 661, 1349, 1418
AluI	AGCT	6 cut(s)	101, 117, 556, 661, 1349, 1418
Alw21I	GWGCWC	1 cut(s)	780
Alw26I	GTCTC	2 cut(s)	951, 1381
Alw44I	GTGCAC	1 cut(s)	776
Ama87I	CYCGRG	2 cut(s)	817, 948
AoxI	GGCC	9 cut(s)	161, 236, 275, 550, 843, 1001, 1053, 1308, 1463
ApaLI	GTGCAC	1 cut(s)	776
ApeKI	GCWGC	4 cut(s)	40, 136, 556, 609
ApoI	RAATTY	1 cut(s)	355
AsiGI	ACCGGT	1 cut(s)	1432
Asp700I	GAANNNNTTC	1 cut(s)	211
AspS9I	GGNCC	3 cut(s)	488, 1054, 1189
AsuC2I	CCSGG	1 cut(s)	729
AsuHPI	GGTGA	5 cut(s)	32, 1241, 1422, 1442, 1469
AsuII	TTCGAA	1 cut(s)	1206
AsuNHI	GCTAGC	1 cut(s)	127
AvaI	CYCGRG	2 cut(s)	817, 948
AvaII	GGWCC	2 cut(s)	488, 1189
BaeGI	GKGCMC	1 cut(s)	780
BalI	TGGCCA	2 cut(s)	552, 1310
BanII	GRGCYC	2 cut(s)	266, 734
BauI	CACGAG	1 cut(s)	920
BbsI	GAAGAC	3 cut(s)	622, 675, 785
Bbv12I	GWGCWC	1 cut(s)	780
BbvI	GCAGC	4 cut(s)	27, 148, 543, 621
BccI	CCATC	5 cut(s)	139, 189, 253, 1076, 1276
BceAI	ACGGC	3 cut(s)	349, 757, 858
BciT130I	CCWGG	2 cut(s)	824, 1462
BclI	TGATCA	3 cut(s)	1243, 1270, 1276
BcnI	CCSGG	1 cut(s)	729
BcoDI	GTCTC	2 cut(s)	951, 1381
BcuI	ACTAGT	2 cut(s)	1406, 1472
BfaI	CTAG	4 cut(s)	128, 342, 1407, 1473
BglII	AGATCT	2 cut(s)	86, 861
BisI	GCNGC	6 cut(s)	41, 137, 164, 180, 557, 610
BlsI	GCNGC	6 cut(s)	42, 138, 165, 181, 558, 611
Bme1390I	CCNGG	3 cut(s)	729, 824, 1462
Bme18I	GGWCC	2 cut(s)	488, 1189
BmeT110I	CYCGRG	2 cut(s)	817, 948
BmgBI	CACGTC	1 cut(s)	55
BmgT120I	GGNCC	3 cut(s)	488, 1054, 1189
BmiI	GGNNCC	1 cut(s)	813
BmrFI	CCNGG	3 cut(s)	729, 824, 1462
BmsI	GCATC	2 cut(s)	568, 889
BmtI	GCTAGC	1 cut(s)	131
BpiI	GAAGAC	3 cut(s)	622, 675, 785
BplI	GAGNNNNNCTC	2 cut(s)	579, 611
BpmI	CTGGAG	1 cut(s)	772
Bpu10I	CCTNAGC	1 cut(s)	228
Bpu14I	TTCGAA	1 cut(s)	1206
BpuEI	CTTGAG	1 cut(s)	926
BpuMI	CCSGG	1 cut(s)	729
BsaBI	GATNNNNATC	1 cut(s)	1275
BsaHI	GRCGYC	1 cut(s)	1390
BsaJI	CCNNGG	4 cut(s)	174, 239, 282, 1460
BsaWI	WCCGGW	4 cut(s)	1399, 1411, 1432, 1452
BsaXI	ACNNNNNCTCC	2 cut(s)	770, 800
Bsc4I	CCNNNNNNNGG	6 cut(s)	284, 442, 823, 1399, 1418, 1486
Bse118I	RCCGGY	3 cut(s)	836, 1432, 1465
Bse1I	ACTGG	3 cut(s)	79, 789, 803
Bse3DI	GCAATG	2 cut(s)	453, 893
Bse8I	GATNNNNATC	1 cut(s)	1275
BseBI	CCWGG	2 cut(s)	824, 1462
BseDI	CCNNGG	4 cut(s)	174, 239, 282, 1460
BseGI	GGATG	5 cut(s)	200, 529, 559, 904, 1378
BseJI	GATNNNNATC	1 cut(s)	1275
BseLI	CCNNNNNNNGG	6 cut(s)	284, 442, 823, 1399, 1418, 1486
BseMI	GCAATG	2 cut(s)	453, 893
BseMII	CTCAG	5 cut(s)	242, 393, 556, 653, 821
BseNI	ACTGG	3 cut(s)	79, 789, 803
BseRI	GAGGAG	2 cut(s)	984, 1112
BseSI	GKGCMC	1 cut(s)	780
BseXI	GCAGC	4 cut(s)	27, 148, 543, 621
BsgI	GTGCAG	3 cut(s)	326, 752, 1161
Bsh1285I	CGRYCG	2 cut(s)	676, 1437
BshFI	GGCC	9 cut(s)	163, 238, 277, 552, 845, 1003, 1055, 1310, 1465
BshTI	ACCGGT	1 cut(s)	1432
BsiEI	CGRYCG	2 cut(s)	676, 1437
BsiHKAI	GWGCWC	1 cut(s)	780
BsiHKCI	CYCGRG	2 cut(s)	817, 948
BsiSI	CCGG	9 cut(s)	728, 837, 1393, 1400, 1412, 1433, 1453, 1466, 1487
BslFI	GGGAC	2 cut(s)	1232, 1443
BslI	CCNNNNNNNGG	6 cut(s)	284, 442, 823, 1399, 1418, 1486
BsmAI	GTCTC	2 cut(s)	951, 1381
BsmBI	CGTCTC	1 cut(s)	1381
BsmFI	GGGAC	2 cut(s)	1232, 1443
BsmI	GAATGC	1 cut(s)	647
BsnI	GGCC	9 cut(s)	163, 238, 277, 552, 845, 1003, 1055, 1310, 1465
BsoBI	CYCGRG	2 cut(s)	817, 948
Bsp119I	TTCGAA	1 cut(s)	1206
Bsp1286I	GDGCHC	3 cut(s)	266, 734, 780
Bsp143I	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
Bsp19I	CCATGG	1 cut(s)	174
BspACI	CCGC	9 cut(s)	139, 164, 179, 467, 645, 720, 884, 1303, 1325
BspANI	GGCC	9 cut(s)	163, 238, 277, 552, 845, 1003, 1055, 1310, 1465
BspCNI	CTCAG	5 cut(s)	241, 394, 555, 654, 820
BspHI	TCATGA	2 cut(s)	633, 1273
BspLI	GGNNCC	1 cut(s)	813
BspOI	GCTAGC	1 cut(s)	131
BspT104I	TTCGAA	1 cut(s)	1206
BsrBI	CCGCTC	1 cut(s)	1325
BsrDI	GCAATG	2 cut(s)	453, 893
BsrFI	RCCGGY	3 cut(s)	836, 1432, 1465
BsrI	ACTGG	3 cut(s)	79, 789, 803
BssAI	RCCGGY	3 cut(s)	836, 1432, 1465
BssECI	CCNNGG	4 cut(s)	174, 239, 282, 1460
BssMI	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
BssNI	GRCGYC	1 cut(s)	1390
BssSI	CACGAG	1 cut(s)	920
BssT1I	CCWWGG	2 cut(s)	174, 239
Bst2BI	CACGAG	1 cut(s)	920
Bst2UI	CCWGG	2 cut(s)	824, 1462
Bst4CI	ACNGT	5 cut(s)	10, 423, 437, 628, 1223
Bst6I	CTCTTC	3 cut(s)	149, 716, 1089
BstACI	GRCGYC	1 cut(s)	1390
BstAPI	GCANNNNNTGC	1 cut(s)	775
BstBI	TTCGAA	1 cut(s)	1206
BstC8I	GCNNGC	4 cut(s)	129, 554, 767, 1001
BstDEI	CTNAG	7 cut(s)	228, 402, 542, 662, 807, 873, 1512
BstDSI	CCRYGG	2 cut(s)	174, 282
BstEII	GGTNACC	1 cut(s)	1428
BstF5I	GGATG	5 cut(s)	200, 529, 559, 904, 1378
BstKTI	GATC	9 cut(s)	89, 519, 676, 864, 1246, 1273, 1279, 1344, 1378
BstMAI	GTCTC	2 cut(s)	951, 1381
BstMBI	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
BstMCI	CGRYCG	2 cut(s)	676, 1437
BstMWI	GCNNNNNNNGC	7 cut(s)	133, 224, 347, 775, 828, 837, 1139
BstNI	CCWGG	2 cut(s)	824, 1462
BstNSI	RCATGY	1 cut(s)	536
BstPI	GGTNACC	1 cut(s)	1428
BstSCI	CCNGG	3 cut(s)	727, 822, 1460
BstSLI	GKGCMC	1 cut(s)	780
BstV1I	GCAGC	4 cut(s)	27, 148, 543, 621
BstV2I	GAAGAC	3 cut(s)	622, 675, 785
BstX2I	RGATCY	2 cut(s)	86, 861
BstYI	RGATCY	2 cut(s)	86, 861
BsuRI	GGCC	9 cut(s)	163, 238, 277, 552, 845, 1003, 1055, 1310, 1465
BtgI	CCRYGG	2 cut(s)	174, 282
BtrI	CACGTC	1 cut(s)	55
BtsCI	GGATG	5 cut(s)	200, 529, 559, 904, 1378
BtsI	GCAGTG	1 cut(s)	553
BtsIMutI	CAGTG	4 cut(s)	86, 399, 553, 796
Cac8I	GCNNGC	4 cut(s)	129, 554, 767, 1001
CciI	TCATGA	2 cut(s)	633, 1273
Cfr10I	RCCGGY	3 cut(s)	836, 1432, 1465
Cfr13I	GGNCC	3 cut(s)	488, 1054, 1189
CseI	GACGC	2 cut(s)	46, 1398
Csp6I	GTAC	1 cut(s)	904
CspAI	ACCGGT	1 cut(s)	1432
CviAII	CATG	9 cut(s)	175, 319, 520, 533, 634, 994, 1072, 1137, 1274
CviQI	GTAC	1 cut(s)	904
DdeI	CTNAG	7 cut(s)	228, 402, 542, 662, 807, 873, 1512
DpnI	GATC	9 cut(s)	88, 518, 675, 863, 1245, 1272, 1278, 1343, 1377
DpnII	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
DraIII	CACNNNGTG	1 cut(s)	775
EaeI	YGGCCR	3 cut(s)	550, 1308, 1463
Eam1104I	CTCTTC	3 cut(s)	149, 716, 1089
EarI	CTCTTC	3 cut(s)	149, 716, 1089
Eco130I	CCWWGG	2 cut(s)	174, 239
Eco24I	GRGCYC	2 cut(s)	266, 734
Eco47I	GGWCC	2 cut(s)	488, 1189
Eco57I	CTGAAG	1 cut(s)	1172
Eco88I	CYCGRG	2 cut(s)	817, 948
Eco91I	GGTNACC	1 cut(s)	1428
EcoO65I	GGTNACC	1 cut(s)	1428
EcoRII	CCWGG	2 cut(s)	822, 1460
EcoT14I	CCWWGG	2 cut(s)	174, 239
EcoT38I	GRGCYC	2 cut(s)	266, 734
ErhI	CCWWGG	2 cut(s)	174, 239
Esp3I	CGTCTC	1 cut(s)	1381
FaeI	CATG	9 cut(s)	178, 322, 523, 536, 637, 997, 1075, 1140, 1277
FaqI	GGGAC	2 cut(s)	1232, 1443
FatI	CATG	9 cut(s)	174, 318, 519, 532, 633, 993, 1071, 1136, 1273
FauI	CCCGC	2 cut(s)	652, 1296
FbaI	TGATCA	3 cut(s)	1243, 1270, 1276
FblI	GTMKAC	1 cut(s)	5
Fnu4HI	GCNGC	6 cut(s)	41, 137, 164, 180, 557, 610
FokI	GGATG	5 cut(s)	207, 536, 546, 911, 1385
FriOI	GRGCYC	2 cut(s)	266, 734
Fsp4HI	GCNGC	6 cut(s)	41, 137, 164, 180, 557, 610
FspBI	CTAG	4 cut(s)	128, 342, 1407, 1473
GluI	GCNGC	6 cut(s)	41, 137, 164, 180, 557, 610
GsuI	CTGGAG	1 cut(s)	772
HaeIII	GGCC	9 cut(s)	163, 238, 277, 552, 845, 1003, 1055, 1310, 1465
HapII	CCGG	9 cut(s)	728, 837, 1393, 1400, 1412, 1433, 1453, 1466, 1487
HgaI	GACGC	2 cut(s)	46, 1398
Hin1I	GRCGYC	1 cut(s)	1390
Hin1II	CATG	9 cut(s)	178, 322, 523, 536, 637, 997, 1075, 1140, 1277
HincII	GTYRAC	2 cut(s)	6, 36
HindII	GTYRAC	2 cut(s)	6, 36
HinfI	GANTC	9 cut(s)	170, 288, 1109, 1175, 1334, 1396, 1422, 1456, 1483
HpaII	CCGG	9 cut(s)	728, 837, 1393, 1400, 1412, 1433, 1453, 1466, 1487
HphI	GGTGA	5 cut(s)	32, 1241, 1422, 1442, 1469
Hpy166II	GTNNAC	3 cut(s)	6, 36, 778
Hpy188I	TCNGA	7 cut(s)	73, 361, 369, 514, 1081, 1281, 1386
Hpy188III	TCNNGA	5 cut(s)	15, 486, 634, 1274, 1357
Hpy8I	GTNNAC	3 cut(s)	6, 36, 778
Hpy99I	CGWCG	3 cut(s)	59, 571, 574
HpyAV	CCTTC	4 cut(s)	153, 196, 288, 1123
HpyCH4III	ACNGT	5 cut(s)	10, 423, 437, 628, 1223
HpyCH4IV	ACGT	2 cut(s)	54, 111
HpyCH4V	TGCA	8 cut(s)	307, 559, 609, 769, 778, 1061, 1142, 1165
HpyF10VI	GCNNNNNNNGC	7 cut(s)	133, 224, 347, 775, 828, 837, 1139
HpyF3I	CTNAG	7 cut(s)	228, 402, 542, 662, 807, 873, 1512
HpySE526I	ACGT	2 cut(s)	54, 111
Hsp92I	GRCGYC	1 cut(s)	1390
Hsp92II	CATG	9 cut(s)	178, 322, 523, 536, 637, 997, 1075, 1140, 1277
Ksp22I	TGATCA	3 cut(s)	1243, 1270, 1276
Kzo9I	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
LmnI	GCTCC	2 cut(s)	29, 1126
Lsp1109I	GCAGC	4 cut(s)	27, 148, 543, 621
LweI	GCATC	2 cut(s)	568, 889
MaeI	CTAG	4 cut(s)	128, 342, 1407, 1473
MaeII	ACGT	2 cut(s)	54, 111
MaeIII	GTNAC	6 cut(s)	50, 1402, 1428, 1448, 1468, 1475
MalI	GATC	9 cut(s)	88, 518, 675, 863, 1245, 1272, 1278, 1343, 1377
MbiI	CCGCTC	1 cut(s)	1325
MboI	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
MboII	GAAGA	9 cut(s)	166, 622, 680, 703, 785, 871, 968, 987, 1106
MflI	RGATCY	2 cut(s)	86, 861
MhlI	GDGCHC	3 cut(s)	266, 734, 780
MlsI	TGGCCA	2 cut(s)	552, 1310
MluCI	AATT	4 cut(s)	355, 914, 1209, 1365
MluNI	TGGCCA	2 cut(s)	552, 1310
MlyI	GAGTC	3 cut(s)	1343, 1465, 1492
MmeI	TCCRAC	1 cut(s)	946
Mox20I	TGGCCA	2 cut(s)	552, 1310
MroXI	GAANNNNTTC	1 cut(s)	211
MscI	TGGCCA	2 cut(s)	552, 1310
MseI	TTAA	1 cut(s)	1260
Msp20I	TGGCCA	2 cut(s)	552, 1310
MspA1I	CMGCKG	3 cut(s)	139, 556, 722
MspI	CCGG	9 cut(s)	728, 837, 1393, 1400, 1412, 1433, 1453, 1466, 1487
MspR9I	CCNGG	3 cut(s)	729, 824, 1462
Mva1269I	GAATGC	1 cut(s)	647
MvaI	CCWGG	2 cut(s)	824, 1462
MwoI	GCNNNNNNNGC	7 cut(s)	133, 224, 347, 775, 828, 837, 1139
NciI	CCSGG	1 cut(s)	729
NcoI	CCATGG	1 cut(s)	174
NdeII	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
NheI	GCTAGC	1 cut(s)	127
NlaIII	CATG	9 cut(s)	178, 322, 523, 536, 637, 997, 1075, 1140, 1277
NlaIV	GGNNCC	1 cut(s)	813
NmuCI	GTSAC	6 cut(s)	50, 1402, 1428, 1448, 1468, 1475
NspI	RCATGY	1 cut(s)	536
NspV	TTCGAA	1 cut(s)	1206
PagI	TCATGA	2 cut(s)	633, 1273
PctI	GAATGC	1 cut(s)	647
PdmI	GAANNNNTTC	1 cut(s)	211
PfeI	GAWTC	6 cut(s)	170, 288, 1109, 1175, 1396, 1422
PflFI	GACNNNGTC	1 cut(s)	10
PinAI	ACCGGT	1 cut(s)	1432
PkrI	GCNGC	6 cut(s)	42, 138, 165, 181, 558, 611
Ple19I	CGATCG	1 cut(s)	676
PleI	GAGTC	3 cut(s)	1342, 1464, 1491
PpsI	GAGTC	3 cut(s)	1342, 1464, 1491
Psp1406I	AACGTT	1 cut(s)	111
Psp6I	CCWGG	2 cut(s)	822, 1460
PspEI	GGTNACC	1 cut(s)	1428
PspGI	CCWGG	2 cut(s)	822, 1460
PspN4I	GGNNCC	1 cut(s)	813
PspPI	GGNCC	3 cut(s)	488, 1054, 1189
PsuI	RGATCY	2 cut(s)	86, 861
PsyI	GACNNNGTC	1 cut(s)	10
PvuI	CGATCG	1 cut(s)	676
PvuII	CAGCTG	1 cut(s)	556
RsaI	GTAC	1 cut(s)	905
RsaNI	GTAC	1 cut(s)	904
SalI	GTCGAC	1 cut(s)	4
SaqAI	TTAA	1 cut(s)	1260
SatI	GCNGC	6 cut(s)	41, 137, 164, 180, 557, 610
Sau3AI	GATC	9 cut(s)	86, 516, 673, 861, 1243, 1270, 1276, 1341, 1375
Sau96I	GGNCC	3 cut(s)	488, 1054, 1189
SchI	GAGTC	3 cut(s)	1343, 1465, 1492
ScrFI	CCNGG	3 cut(s)	729, 824, 1462
SduI	GDGCHC	3 cut(s)	266, 734, 780
SfaNI	GCATC	2 cut(s)	568, 889
SfuI	TTCGAA	1 cut(s)	1206
SinI	GGWCC	2 cut(s)	488, 1189
SmlI	CTYRAG	1 cut(s)	941
SmoI	CTYRAG	1 cut(s)	941
SpeI	ACTAGT	2 cut(s)	1406, 1472
Sse9I	AATT	4 cut(s)	355, 914, 1209, 1365
SsiI	CCGC	9 cut(s)	139, 164, 179, 467, 645, 720, 884, 1303, 1325
SspI	AATATT	1 cut(s)	378
SspMI	CTAG	4 cut(s)	128, 342, 1407, 1473
StyD4I	CCNGG	3 cut(s)	727, 822, 1460
StyI	CCWWGG	2 cut(s)	174, 239
TaaI	ACNGT	5 cut(s)	10, 423, 437, 628, 1223
TaiI	ACGT	2 cut(s)	57, 114
TaqI	TCGA	5 cut(s)	5, 291, 417, 1206, 1344
TaqII	GACCGA	1 cut(s)	1206
TasI	AATT	4 cut(s)	355, 914, 1209, 1365
TauI	GCSGC	2 cut(s)	166, 182
TfiI	GAWTC	6 cut(s)	170, 288, 1109, 1175, 1396, 1422
Tru1I	TTAA	1 cut(s)	1260
Tru9I	TTAA	1 cut(s)	1260
TscAI	CASTG	4 cut(s)	86, 406, 553, 803
TseFI	GTSAC	6 cut(s)	50, 1402, 1428, 1448, 1468, 1475
TseI	GCWGC	4 cut(s)	40, 136, 556, 609
Tsp45I	GTSAC	6 cut(s)	50, 1402, 1428, 1448, 1468, 1475
TspDTI	ATGAA	5 cut(s)	335, 622, 703, 982, 1171
TspGWI	ACGGA	1 cut(s)	271
TspRI	CASTG	4 cut(s)	86, 406, 553, 803
Tth111I	GACNNNGTC	1 cut(s)	10
VneI	GTGCAC	1 cut(s)	776
VpaK11BI	GGWCC	2 cut(s)	488, 1189
XapI	RAATTY	1 cut(s)	355
XceI	RCATGY	1 cut(s)	536
XcmI	CCANNNNNNNNNTGG	3 cut(s)	86, 545, 1324
XmiI	GTMKAC	1 cut(s)	5
XmnI	GAANNNNTTC	1 cut(s)	211
XspI	CTAG	4 cut(s)	128, 342, 1407, 1473

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.