Rroxscaffold_3G00246070

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
39164852 .. 39165175
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00246070.1

Sequence Viewer

Length: 324 bp
ATGCCCAACCAATCCCCACCATCGACCTCTCCGACCTCCACTCCGATCTCTCGCTCCGCCATCGTCGACCAAGTTAGCGGTGCGTGCCGCAACTTCGATTTCTTCCGCATCACCAACCACGGCATTTCGTTGGTGGTTCTCGACCATACCATCGCTGCCGTCAAGGCCTCCCACGAGCAGCCGACGGCGGTCAAGGCGCGGTTCTACCGTAGAGAGATGGGCCGGGCGTATCGTATCTGTCCAACGTCGACCCGTACACCTCCAAAGCCGCCACCGGCGCGACATGCTTCAAGGAAGCCTCGGCCCTGTTCCGGCTGCAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.71

Weight (kDa)

10.85

Isoelectric Point (pI)

51.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DIOX_N PF14226 16 - 78 2.8e-09 non-haem dioxygenase in morphine synthesis N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 66, 248
AccII CGCG 2 cut(s) 199, 280
AciI CCGC 7 cut(s) 57, 78, 88, 106, 188, 199, 269
AfaI GTAC 1 cut(s) 256
AfiI CCNNNNNNNGG 1 cut(s) 311
AgsI TTSAA 1 cut(s) 291
AoxI GGCC 3 cut(s) 165, 220, 302
ApeKI GCWGC 3 cut(s) 155, 178, 315
AspLEI GCGC 2 cut(s) 199, 280
AspS9I GGNCC 2 cut(s) 220, 303
AsuC2I CCSGG 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 103
BauI CACGAG 1 cut(s) 173
BbvI GCAGC 3 cut(s) 142, 190, 302
BccI CCATC 4 cut(s) 28, 68, 158, 211
BceAI ACGGC 3 cut(s) 136, 143, 201
BcnI CCSGG 1 cut(s) 224
BfmI CTRYAG 1 cut(s) 316
BglI GCCNNNNNGGC 1 cut(s) 164
BisI GCNGC 5 cut(s) 88, 156, 179, 269, 316
BlsI GCNGC 5 cut(s) 89, 157, 180, 270, 317
Bme1390I CCNGG 1 cut(s) 224
BmgT120I GGNCC 2 cut(s) 220, 303
BmrFI CCNGG 1 cut(s) 224
BmsI GCATC 1 cut(s) 117
BoxI GACNNNNGTC 1 cut(s) 188
BpuMI CCSGG 1 cut(s) 224
BsaJI CCNNGG 2 cut(s) 118, 299
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
Bsc4I CCNNNNNNNGG 1 cut(s) 311
Bse118I RCCGGY 1 cut(s) 274
BseDI CCNNGG 2 cut(s) 118, 299
BseLI CCNNNNNNNGG 1 cut(s) 311
BseXI GCAGC 3 cut(s) 142, 190, 302
Bsh1236I CGCG 2 cut(s) 199, 280
BshFI GGCC 3 cut(s) 167, 222, 304
BsiSI CCGG 3 cut(s) 223, 275, 312
BslI CCNNNNNNNGG 1 cut(s) 311
BsnI GGCC 3 cut(s) 167, 222, 304
Bsp143I GATC 1 cut(s) 45
BspACI CCGC 7 cut(s) 57, 78, 88, 106, 188, 199, 269
BspANI GGCC 3 cut(s) 167, 222, 304
BspFNI CGCG 2 cut(s) 199, 280
BspMAI CTGCAG 1 cut(s) 320
BsrFI RCCGGY 1 cut(s) 274
BssAI RCCGGY 1 cut(s) 274
BssECI CCNNGG 2 cut(s) 118, 299
BssMI GATC 1 cut(s) 45
BssSI CACGAG 1 cut(s) 173
Bst2BI CACGAG 1 cut(s) 173
Bst4CI ACNGT 1 cut(s) 209
BstC8I GCNNGC 1 cut(s) 85
BstDSI CCRYGG 1 cut(s) 118
BstFNI CGCG 2 cut(s) 199, 280
BstHHI GCGC 2 cut(s) 199, 280
BstKTI GATC 1 cut(s) 48
BstMBI GATC 1 cut(s) 45
BstMWI GCNNNNNNNGC 5 cut(s) 84, 164, 194, 277, 284
BstNSI RCATGY 1 cut(s) 287
BstPAI GACNNNNGTC 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 222
BstSFI CTRYAG 1 cut(s) 316
BstUI CGCG 2 cut(s) 199, 280
BstV1I GCAGC 3 cut(s) 142, 190, 302
BsuRI GGCC 3 cut(s) 167, 222, 304
BtgI CCRYGG 1 cut(s) 118
BtgZI GCGATG 1 cut(s) 136
Cac8I GCNNGC 1 cut(s) 85
CfoI GCGC 2 cut(s) 199, 280
Cfr10I RCCGGY 1 cut(s) 274
Cfr13I GGNCC 2 cut(s) 220, 303
Csp6I GTAC 1 cut(s) 255
CviAII CATG 1 cut(s) 284
CviJI RGCY 7 cut(s) 167, 181, 222, 268, 298, 304, 315
CviKI_1 RGCY 7 cut(s) 167, 181, 222, 268, 298, 304, 315
CviQI GTAC 1 cut(s) 255
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
EciI GGCGGA 1 cut(s) 46
Eco147I AGGCCT 1 cut(s) 167
FaeI CATG 1 cut(s) 287
FaiI YATR 2 cut(s) 147, 285
FatI CATG 1 cut(s) 283
FblI GTMKAC 2 cut(s) 66, 248
Fnu4HI GCNGC 5 cut(s) 88, 156, 179, 269, 316
Fsp4HI GCNGC 5 cut(s) 88, 156, 179, 269, 316
GlaI GCGC 2 cut(s) 198, 279
GluI GCNGC 5 cut(s) 88, 156, 179, 269, 316
HaeIII GGCC 3 cut(s) 167, 222, 304
HapII CCGG 3 cut(s) 223, 275, 312
HhaI GCGC 2 cut(s) 199, 280
Hin1II CATG 1 cut(s) 287
Hin6I GCGC 2 cut(s) 197, 278
HinP1I GCGC 2 cut(s) 197, 278
HincII GTYRAC 2 cut(s) 67, 249
HindII GTYRAC 2 cut(s) 67, 249
HpaII CCGG 3 cut(s) 223, 275, 312
HphI GGTGA 1 cut(s) 103
Hpy166II GTNNAC 3 cut(s) 67, 249, 257
Hpy188I TCNGA 2 cut(s) 33, 45
Hpy188III TCNNGA 1 cut(s) 140
Hpy8I GTNNAC 3 cut(s) 67, 249, 257
Hpy99I CGWCG 3 cut(s) 68, 187, 250
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4IV ACGT 1 cut(s) 245
HpyCH4V TGCA 1 cut(s) 318
HpyF10VI GCNNNNNNNGC 5 cut(s) 84, 164, 194, 277, 284
HpySE526I ACGT 1 cut(s) 245
Hsp92II CATG 1 cut(s) 287
HspAI GCGC 2 cut(s) 197, 278
Kzo9I GATC 1 cut(s) 45
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 3 cut(s) 236, 288, 319
Lsp1109I GCAGC 3 cut(s) 142, 190, 302
LweI GCATC 1 cut(s) 117
MaeII ACGT 1 cut(s) 245
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 1 cut(s) 94
MmeI TCCRAC 2 cut(s) 56, 266
MnlI CCTC 5 cut(s) 37, 46, 178, 270, 309
MspI CCGG 3 cut(s) 223, 275, 312
MspR9I CCNGG 1 cut(s) 224
MvnI CGCG 2 cut(s) 199, 280
MwoI GCNNNNNNNGC 5 cut(s) 84, 164, 194, 277, 284
NciI CCSGG 1 cut(s) 224
NdeII GATC 1 cut(s) 45
NlaIII CATG 1 cut(s) 287
NmeAIII GCCGAG 1 cut(s) 280
NspI RCATGY 1 cut(s) 287
PceI AGGCCT 1 cut(s) 167
PcsI WCGNNNNNNNCGW 1 cut(s) 29
PkrI GCNGC 5 cut(s) 89, 157, 180, 270, 317
PshAI GACNNNNGTC 1 cut(s) 188
PspPI GGNCC 2 cut(s) 220, 303
PstI CTGCAG 1 cut(s) 320
RsaI GTAC 1 cut(s) 256
RsaNI GTAC 1 cut(s) 255
SalI GTCGAC 2 cut(s) 65, 247
SatI GCNGC 5 cut(s) 88, 156, 179, 269, 316
Sau3AI GATC 1 cut(s) 45
Sau96I GGNCC 2 cut(s) 220, 303
ScrFI CCNGG 1 cut(s) 224
SetI ASST 4 cut(s) 29, 38, 248, 262
SfaNI GCATC 1 cut(s) 117
SfcI CTRYAG 1 cut(s) 316
SgrAI CRCCGGYG 1 cut(s) 274
SseBI AGGCCT 1 cut(s) 167
SsiI CCGC 7 cut(s) 57, 78, 88, 106, 188, 199, 269
StuI AGGCCT 1 cut(s) 167
StyD4I CCNGG 1 cut(s) 222
TaaI ACNGT 1 cut(s) 209
TaiI ACGT 1 cut(s) 248
TaqI TCGA 5 cut(s) 23, 66, 96, 141, 248
TauI GCSGC 2 cut(s) 90, 271
TseI GCWGC 3 cut(s) 155, 178, 315
XceI RCATGY 1 cut(s) 287
XmiI GTMKAC 2 cut(s) 66, 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.