Rh4DG406400

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0001116
Physical Location & Seq
Reverse (-)
62014192 .. 62014899
708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG406400.1

Sequence Viewer

Length: 186 bp
ATGAAAATTCAGATTATTTCGAATGAGGAATACAAAAGCGTGGATCACCGGGTGTTGGCGAATCCACACCACGAGCCTCGTGTCTCAATAGCCGTGTTTTTGAACCCGAGCAATAGAGAGGGGGTGTTTGGTCCTTTCGCGAGAGTTGGTATCTCCGGAGAAGCCAGCTCTCTACAAAGAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

61

Amino Acids

6.79

Weight (kDa)

8.31

Isoelectric Point (pI)

23.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy PF03171 3 - 36 8.5e-06 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 140
AccIII TCCGGA 1 cut(s) 155
AclWI GGATC 1 cut(s) 51
AcsI RAATTY 1 cut(s) 6
AdeI CACNNNGTG 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 103
AluBI AGCT 1 cut(s) 168
AluI AGCT 1 cut(s) 168
Alw26I GTCTC 1 cut(s) 88
AlwI GGATC 1 cut(s) 51
Ama87I CYCGRG 1 cut(s) 106
Aor13HI TCCGGA 1 cut(s) 155
ApoI RAATTY 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 131
AsuC2I CCSGG 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 38
AsuII TTCGAA 1 cut(s) 20
AvaI CYCGRG 1 cut(s) 106
AvaII GGWCC 1 cut(s) 131
BauI CACGAG 2 cut(s) 71, 78
BceAI ACGGC 1 cut(s) 77
BcnI CCSGG 1 cut(s) 50
BcoDI GTCTC 1 cut(s) 88
Bme1390I CCNGG 1 cut(s) 50
Bme18I GGWCC 1 cut(s) 131
BmeT110I CYCGRG 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 50
Bpu14I TTCGAA 1 cut(s) 20
BpuMI CCSGG 1 cut(s) 50
BsaWI WCCGGW 1 cut(s) 155
Bsc4I CCNNNNNNNGG 1 cut(s) 55
BseAI TCCGGA 1 cut(s) 155
BseLI CCNNNNNNNGG 1 cut(s) 55
Bsh1236I CGCG 1 cut(s) 140
BsiHKCI CYCGRG 1 cut(s) 106
BsiSI CCGG 2 cut(s) 49, 156
BslI CCNNNNNNNGG 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 88
BsoBI CYCGRG 1 cut(s) 106
Bsp119I TTCGAA 1 cut(s) 20
Bsp13I TCCGGA 1 cut(s) 155
Bsp143I GATC 1 cut(s) 43
Bsp68I TCGCGA 1 cut(s) 140
BspEI TCCGGA 1 cut(s) 155
BspFNI CGCG 1 cut(s) 140
BspPI GGATC 1 cut(s) 51
BspT104I TTCGAA 1 cut(s) 20
BssMI GATC 1 cut(s) 43
BssSI CACGAG 2 cut(s) 71, 78
Bst2BI CACGAG 2 cut(s) 71, 78
BstBI TTCGAA 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 166
BstFNI CGCG 1 cut(s) 140
BstKTI GATC 1 cut(s) 46
BstMAI GTCTC 1 cut(s) 88
BstMBI GATC 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 48
BstUI CGCG 1 cut(s) 140
BtuMI TCGCGA 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 166
Cfr13I GGNCC 1 cut(s) 131
CviJI RGCY 4 cut(s) 76, 92, 164, 168
CviKI_1 RGCY 4 cut(s) 76, 92, 164, 168
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
DraIII CACNNNGTG 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 131
Eco88I CYCGRG 1 cut(s) 106
HapII CCGG 2 cut(s) 49, 156
HinfI GANTC 1 cut(s) 61
HpaII CCGG 2 cut(s) 49, 156
HphI GGTGA 1 cut(s) 38
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 2 cut(s) 139, 156
Kpn2I TCCGGA 1 cut(s) 155
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 3 cut(s) 62, 169, 178
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MluCI AATT 1 cut(s) 6
MnlI CCTC 3 cut(s) 19, 87, 112
MroI TCCGGA 1 cut(s) 155
MseI TTAA 1 cut(s) 184
MspI CCGG 2 cut(s) 49, 156
MspR9I CCNGG 1 cut(s) 50
MvnI CGCG 1 cut(s) 140
NciI CCSGG 1 cut(s) 50
NdeII GATC 1 cut(s) 43
NruI TCGCGA 1 cut(s) 140
NspV TTCGAA 1 cut(s) 20
PfeI GAWTC 1 cut(s) 61
PspPI GGNCC 1 cut(s) 131
RruI TCGCGA 1 cut(s) 140
SaqAI TTAA 1 cut(s) 184
Sau3AI GATC 1 cut(s) 43
Sau96I GGNCC 1 cut(s) 131
ScrFI CCNGG 1 cut(s) 50
SetI ASST 1 cut(s) 170
SfuI TTCGAA 1 cut(s) 20
SinI GGWCC 1 cut(s) 131
Sse9I AATT 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 48
TaqI TCGA 1 cut(s) 20
TasI AATT 1 cut(s) 6
TfiI GAWTC 1 cut(s) 61
Tru1I TTAA 1 cut(s) 184
Tru9I TTAA 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 131
XapI RAATTY 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.