Rroxscaffold_6G00390280

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
5019983 .. 5027299
7317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00390280.1

Sequence Viewer

Length: 324 bp
ATGGATGGGATAAGCTGTAATGGATTTTTGGGGTGGATGTTATCAGAGAATTCGTGGGGTTGTATTGTTGGGGGGAATTGCAAGTTTGGTTCCAATTACAGGTTTAATCACCCTGATCCTACTGCTGCATCATTACAAGGTGGATCGCAATCATCATCTTGGTCTACACCAAGATCATTGAATGAGACTCCGCTTTATATGCCAATGATGATGCTGCCATCTCAAGGGGTTCCTTCTCAAAATACAGAATGGAATGGCTACCAGGCACCAGTTTATCTAGGAAGAAGCATGCACCAGCAGGCCGTCCAAAAGAAAAGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.84

Weight (kDa)

8.93

Isoelectric Point (pI)

61.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000602)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G48195 AT3G48440 AT5G63260 AT5G63260
fragaria_vesca FvH4_5g07100 FvH4_5g07100 FvH4_5g07100 FvH4_5g07100 FvH4_5g07100 FvH4_5g07100 FvH4_5g07100
malus_domestica MD06G1158800.v1.1 MD06G1159000.v1.1 MD06G1159200.v1.1 MD14G1165100.v1.1 MD14G1165300.v1.1 MD14G1165400.v1.1 MD14G1165500.v1.1
prunus_persica Prupe.5G158300_v2.0.a1 Prupe.5G158300_v2.0.a1 Prupe.5G158400_v2.0.a1 Prupe.5G158400_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158500_v2.0.a1 Prupe.5G158600_v2.0.a1 Prupe.5G158700_v2.0.a1 Prupe.5G158800_v2.0.a1 Prupe.5G158900_v2.0.a1 Prupe.5G159000_v2.0.a1 Prupe.5G159100_v2.0.a1 Prupe.5G159100_v2.0.a1
pyrus_communis pycom02g00910 pycom06g14200 pycom14g13760 pycom14g13790 pycom14g13800
rosa_chinensis RchiOBHm_Chr5g0019351 RchiOBHm_Chr5g0022771 RchiOBHm_Chr7g0191441 RchiOBHm_Chr7g0191531
rosa_laevigata RLG00000004449 RLG00000032440
rosa_multiflora Rmu_sc0001809.1_g000062 Rmu_sc0005292.1_g000027
rosa_roxburghii Rroxscaffold_1G00074260 Rroxscaffold_6G00390280 Rroxscaffold_7G00168660
rosa_rugosa Rorug05G0049600 Rorug05G0049700 Rorug05G0049800 Rorug06G0510400
rosa_samantha Rh5CG151400 Rh5DG140300 Rh7AG118400 Rh7BG120400 Rh7CG123200 Rh7DG121300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 265
AccI GTMKAC 1 cut(s) 164
AciI CCGC 1 cut(s) 191
AclWI GGATC 2 cut(s) 110, 151
AcsI RAATTY 1 cut(s) 49
AfiI CCNNNNNNNGG 2 cut(s) 99, 224
AgsI TTSAA 1 cut(s) 181
AjnI CCWGG 1 cut(s) 261
AluBI AGCT 1 cut(s) 15
AluI AGCT 1 cut(s) 15
Alw26I GTCTC 1 cut(s) 179
AlwI GGATC 2 cut(s) 110, 151
AoxI GGCC 1 cut(s) 300
ApeKI GCWGC 2 cut(s) 125, 214
ApoI RAATTY 1 cut(s) 49
AsuHPI GGTGA 1 cut(s) 101
BanI GGYRCC 1 cut(s) 265
BbvI GCAGC 2 cut(s) 112, 201
BccI CCATC 1 cut(s) 226
BceAI ACGGC 1 cut(s) 287
BciT130I CCWGG 1 cut(s) 263
BcoDI GTCTC 1 cut(s) 179
BfaI CTAG 1 cut(s) 278
BisI GCNGC 2 cut(s) 126, 215
BlsI GCNGC 2 cut(s) 127, 216
Bme1390I CCNGG 1 cut(s) 263
BmiI GGNNCC 3 cut(s) 91, 231, 267
BmrFI CCNGG 1 cut(s) 263
BmsI GCATC 2 cut(s) 137, 201
BpuEI CTTGAG 1 cut(s) 207
BsaBI GATNNNNATC 1 cut(s) 148
Bsc4I CCNNNNNNNGG 2 cut(s) 99, 224
Bse1I ACTGG 1 cut(s) 269
Bse8I GATNNNNATC 1 cut(s) 148
BseBI CCWGG 1 cut(s) 263
BseGI GGATG 2 cut(s) 10, 42
BseJI GATNNNNATC 1 cut(s) 148
BseLI CCNNNNNNNGG 2 cut(s) 99, 224
BseNI ACTGG 1 cut(s) 269
BseXI GCAGC 2 cut(s) 112, 201
BshFI GGCC 1 cut(s) 302
BshNI GGYRCC 1 cut(s) 265
BslI CCNNNNNNNGG 2 cut(s) 99, 224
BsmAI GTCTC 1 cut(s) 179
BsnI GGCC 1 cut(s) 302
Bsp143I GATC 3 cut(s) 115, 143, 173
BspACI CCGC 1 cut(s) 191
BspANI GGCC 1 cut(s) 302
BspLI GGNNCC 3 cut(s) 91, 231, 267
BspPI GGATC 2 cut(s) 110, 151
BspT107I GGYRCC 1 cut(s) 265
BsrI ACTGG 1 cut(s) 269
BssMI GATC 3 cut(s) 115, 143, 173
Bst2UI CCWGG 1 cut(s) 263
BstC8I GCNNGC 2 cut(s) 290, 300
BstF5I GGATG 2 cut(s) 10, 42
BstKTI GATC 3 cut(s) 118, 146, 176
BstMAI GTCTC 1 cut(s) 179
BstMBI GATC 3 cut(s) 115, 143, 173
BstMWI GCNNNNNNNGC 1 cut(s) 199
BstNI CCWGG 1 cut(s) 263
BstNSI RCATGY 1 cut(s) 292
BstSCI CCNGG 1 cut(s) 261
BstV1I GCAGC 2 cut(s) 112, 201
BsuRI GGCC 1 cut(s) 302
BtsCI GGATG 2 cut(s) 10, 42
Cac8I GCNNGC 2 cut(s) 290, 300
CviAII CATG 1 cut(s) 289
CviJI RGCY 3 cut(s) 15, 258, 302
CviKI_1 RGCY 3 cut(s) 15, 258, 302
DpnI GATC 3 cut(s) 117, 145, 175
DpnII GATC 3 cut(s) 115, 143, 173
EcoRI GAATTC 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 261
FaeI CATG 1 cut(s) 292
FaiI YATR 3 cut(s) 198, 200, 290
FatI CATG 1 cut(s) 288
FblI GTMKAC 1 cut(s) 164
Fnu4HI GCNGC 2 cut(s) 126, 215
FokI GGATG 2 cut(s) 17, 49
Fsp4HI GCNGC 2 cut(s) 126, 215
FspBI CTAG 1 cut(s) 278
GluI GCNGC 2 cut(s) 126, 215
HaeIII GGCC 1 cut(s) 302
Hin1II CATG 1 cut(s) 292
HinfI GANTC 1 cut(s) 187
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 165
Hpy188I TCNGA 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 165
HpyAV CCTTC 1 cut(s) 243
HpyCH4V TGCA 3 cut(s) 81, 128, 292
HpyF10VI GCNNNNNNNGC 1 cut(s) 199
Hsp92II CATG 1 cut(s) 292
Kzo9I GATC 3 cut(s) 115, 143, 173
LpnPI CCDG 7 cut(s) 85, 126, 248, 275, 282, 284, 308
Lsp1109I GCAGC 2 cut(s) 112, 201
LweI GCATC 2 cut(s) 137, 201
MaeI CTAG 1 cut(s) 278
MalI GATC 3 cut(s) 117, 145, 175
MboI GATC 3 cut(s) 115, 143, 173
MboII GAAGA 1 cut(s) 294
MluCI AATT 3 cut(s) 49, 76, 94
MlyI GAGTC 1 cut(s) 181
MseI TTAA 1 cut(s) 105
MspR9I CCNGG 1 cut(s) 263
MvaI CCWGG 1 cut(s) 263
MwoI GCNNNNNNNGC 1 cut(s) 199
NdeII GATC 3 cut(s) 115, 143, 173
NlaIII CATG 1 cut(s) 292
NlaIV GGNNCC 3 cut(s) 91, 231, 267
NspI RCATGY 1 cut(s) 292
PaeI GCATGC 1 cut(s) 292
PkrI GCNGC 2 cut(s) 127, 216
PleI GAGTC 1 cut(s) 181
PpsI GAGTC 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
PspN4I GGNNCC 3 cut(s) 91, 231, 267
SaqAI TTAA 1 cut(s) 105
SatI GCNGC 2 cut(s) 126, 215
Sau3AI GATC 3 cut(s) 115, 143, 173
SchI GAGTC 1 cut(s) 181
ScrFI CCNGG 1 cut(s) 263
SetI ASST 3 cut(s) 17, 104, 142
SfaNI GCATC 2 cut(s) 137, 201
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
SphI GCATGC 1 cut(s) 292
Sse9I AATT 3 cut(s) 49, 76, 94
SsiI CCGC 1 cut(s) 191
SspMI CTAG 1 cut(s) 278
StyD4I CCNGG 1 cut(s) 261
TasI AATT 3 cut(s) 49, 76, 94
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TseI GCWGC 2 cut(s) 125, 214
XapI RAATTY 1 cut(s) 49
XceI RCATGY 1 cut(s) 292
XmiI GTMKAC 1 cut(s) 164
XspI CTAG 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.