Rorug05G0503500

UPF0481 protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
68639631 .. 68640529
899 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0503500.1

Sequence Viewer

Length: 522 bp
ATGAGTTATGGGTTTAATAAGCTTCTTGGAGGACTATCTAGTGTGAAGACCCTAGCTACCAATTCTGATTCCCTTGAGGTGATTCAGACTCATGCAACAGAACTGCTTAGACAGATGCCCTTGTTGAATTACCTAACCACTTTGAAATTGGAAGCAGAGGAAGTAGTTCCCTGTAGCAAAGCACTATTGAGGATGCTTGAAAACTGTCCTTGCCTTCAAACTCTGATATTCTTTCAGGAGATTAACCTGTCCTCAGATGATGCTAACGACGATGGGGTGTTGGAGCCACTGCCTCCATGTTTCCTGACTAGTCTTAAACAGATTAAAGTTCATGCATTCTATGGAGACAAGAAAAATCTTTGTGCAATAAAGATTTTGCTAAAGAATGCCATGGTCTTGGAGAAGATGATCTTAACTTGCATGCACAATTTTGTTGGAGGATCAGAGAAGAAAAAGGATGTTAACAAACAGCTATCAGATCTCCCAAAAGGGTCAGAAAGCTGTGAAGTTGTTCTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.18

Weight (kDa)

5.93

Isoelectric Point (pI)

51.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBD PF08387 97 - 138 6.9e-06 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 448
AgsI TTSAA 4 cut(s) 127, 145, 200, 218
AhlI ACTAGT 1 cut(s) 308
AluBI AGCT 4 cut(s) 22, 56, 472, 501
AluI AGCT 4 cut(s) 22, 56, 472, 501
Alw26I GTCTC 1 cut(s) 339
AlwI GGATC 1 cut(s) 448
Asp700I GAANNNNTTC 2 cut(s) 165, 510
AsuHPI GGTGA 1 cut(s) 91
BbsI GAAGAC 1 cut(s) 53
BccI CCATC 1 cut(s) 266
BcoDI GTCTC 1 cut(s) 339
BcuI ACTAGT 1 cut(s) 308
BfaI CTAG 3 cut(s) 39, 53, 309
BfmI CTRYAG 1 cut(s) 172
BglII AGATCT 1 cut(s) 478
BmiI GGNNCC 1 cut(s) 285
BmsI GCATC 3 cut(s) 105, 183, 250
BpiI GAAGAC 1 cut(s) 53
BpuEI CTTGAG 1 cut(s) 95
BsaJI CCNNGG 1 cut(s) 390
BseDI CCNNGG 1 cut(s) 390
BseGI GGATG 2 cut(s) 198, 463
BseMII CTCAG 1 cut(s) 267
BsmAI GTCTC 1 cut(s) 339
BsmI GAATGC 2 cut(s) 335, 391
Bsp143I GATC 3 cut(s) 408, 440, 478
Bsp19I CCATGG 1 cut(s) 390
BspCNI CTCAG 1 cut(s) 266
BspLI GGNNCC 1 cut(s) 285
BspPI GGATC 1 cut(s) 448
BssECI CCNNGG 1 cut(s) 390
BssMI GATC 3 cut(s) 408, 440, 478
BssT1I CCWWGG 1 cut(s) 390
Bst4CI ACNGT 1 cut(s) 206
BstC8I GCNNGC 1 cut(s) 422
BstDEI CTNAG 2 cut(s) 107, 253
BstDSI CCRYGG 1 cut(s) 390
BstF5I GGATG 2 cut(s) 198, 463
BstKTI GATC 3 cut(s) 411, 443, 481
BstMAI GTCTC 1 cut(s) 339
BstMBI GATC 3 cut(s) 408, 440, 478
BstNSI RCATGY 1 cut(s) 424
BstSFI CTRYAG 1 cut(s) 172
BstV2I GAAGAC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 478
BstXI CCANNNNNNTGG 1 cut(s) 397
BstYI RGATCY 1 cut(s) 478
BtgI CCRYGG 1 cut(s) 390
BtsCI GGATG 2 cut(s) 198, 463
BtsI GCAGTG 1 cut(s) 287
BtsIMutI CAGTG 1 cut(s) 287
Cac8I GCNNGC 1 cut(s) 422
CviAII CATG 5 cut(s) 92, 297, 332, 391, 421
CviJI RGCY 5 cut(s) 22, 56, 286, 472, 501
CviKI_1 RGCY 5 cut(s) 22, 56, 286, 472, 501
DdeI CTNAG 2 cut(s) 107, 253
DpnI GATC 3 cut(s) 410, 442, 480
DpnII GATC 3 cut(s) 408, 440, 478
Eco130I CCWWGG 1 cut(s) 390
EcoT14I CCWWGG 1 cut(s) 390
EcoT22I ATGCAT 1 cut(s) 337
ErhI CCWWGG 1 cut(s) 390
FaeI CATG 5 cut(s) 95, 300, 335, 394, 424
FaiI YATR 7 cut(s) 9, 93, 298, 333, 342, 392, 422
FalI AAGNNNNNCTT 3 cut(s) 395, 427, 498
FatI CATG 5 cut(s) 91, 296, 331, 390, 420
FokI GGATG 2 cut(s) 205, 470
FspBI CTAG 3 cut(s) 39, 53, 309
Hin1II CATG 5 cut(s) 95, 300, 335, 394, 424
HincII GTYRAC 1 cut(s) 463
HindII GTYRAC 1 cut(s) 463
HindIII AAGCTT 1 cut(s) 20
HinfI GANTC 3 cut(s) 68, 82, 88
HpaI GTTAAC 1 cut(s) 463
HphI GGTGA 1 cut(s) 91
Hpy166II GTNNAC 1 cut(s) 463
Hpy188I TCNGA 7 cut(s) 67, 87, 225, 256, 445, 478, 496
Hpy188III TCNNGA 2 cut(s) 236, 304
Hpy8I GTNNAC 1 cut(s) 463
Hpy99I CGWCG 1 cut(s) 272
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 5 cut(s) 95, 335, 365, 420, 424
HpyF3I CTNAG 2 cut(s) 107, 253
Hsp92II CATG 5 cut(s) 95, 300, 335, 394, 424
KspAI GTTAAC 1 cut(s) 463
Kzo9I GATC 3 cut(s) 408, 440, 478
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 4 cut(s) 184, 221, 260, 317
LweI GCATC 3 cut(s) 105, 183, 250
MaeI CTAG 3 cut(s) 39, 53, 309
MalI GATC 3 cut(s) 410, 442, 480
MboI GATC 3 cut(s) 408, 440, 478
MboII GAAGA 3 cut(s) 58, 415, 460
MflI RGATCY 1 cut(s) 478
MluCI AATT 4 cut(s) 61, 127, 146, 427
MlyI GAGTC 1 cut(s) 82
MmeI TCCRAC 2 cut(s) 261, 415
MnlI CCTC 7 cut(s) 23, 70, 151, 183, 262, 303, 431
Mph1103I ATGCAT 1 cut(s) 337
MroXI GAANNNNTTC 2 cut(s) 165, 510
MseI TTAA 6 cut(s) 15, 243, 315, 324, 413, 462
Mva1269I GAATGC 2 cut(s) 335, 391
NcoI CCATGG 1 cut(s) 390
NdeII GATC 3 cut(s) 408, 440, 478
NlaIII CATG 5 cut(s) 95, 300, 335, 394, 424
NlaIV GGNNCC 1 cut(s) 285
NsiI ATGCAT 1 cut(s) 337
NspI RCATGY 1 cut(s) 424
PaeI GCATGC 1 cut(s) 424
PctI GAATGC 2 cut(s) 335, 391
PdmI GAANNNNTTC 2 cut(s) 165, 510
PfeI GAWTC 2 cut(s) 68, 82
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 285
PsuI RGATCY 1 cut(s) 478
SaqAI TTAA 6 cut(s) 15, 243, 315, 324, 413, 462
Sau3AI GATC 3 cut(s) 408, 440, 478
SchI GAGTC 1 cut(s) 82
SetI ASST 7 cut(s) 24, 58, 81, 135, 249, 474, 503
SfaNI GCATC 3 cut(s) 105, 183, 250
SfcI CTRYAG 1 cut(s) 172
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SpeI ACTAGT 1 cut(s) 308
SphI GCATGC 1 cut(s) 424
Sse9I AATT 4 cut(s) 61, 127, 146, 427
SspMI CTAG 3 cut(s) 39, 53, 309
StyI CCWWGG 1 cut(s) 390
TaaI ACNGT 1 cut(s) 206
TasI AATT 4 cut(s) 61, 127, 146, 427
TfiI GAWTC 2 cut(s) 68, 82
Tru1I TTAA 6 cut(s) 15, 243, 315, 324, 413, 462
Tru9I TTAA 6 cut(s) 15, 243, 315, 324, 413, 462
TscAI CASTG 1 cut(s) 294
TspDTI ATGAA 1 cut(s) 320
TspRI CASTG 1 cut(s) 294
XceI RCATGY 1 cut(s) 424
XcmI CCANNNNNNNNNTGG 1 cut(s) 145
XmnI GAANNNNTTC 2 cut(s) 165, 510
XspI CTAG 3 cut(s) 39, 53, 309
Zsp2I ATGCAT 1 cut(s) 337
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.