Rh1AG020700

Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0001468
Physical Location & Seq
Forward (+)
3887610 .. 3888578
969 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG020700.1

Sequence Viewer

Length: 327 bp
ATGGTGATGGTGGTGGTGGCATTCATGAAATTAACTGCTCTTTTCACGAGCAAAATCTATACGCAGCCTTTGCTTAGCCTTTTCTATGCTCAGCCTGGGAATAGCCTTTGGAAATGCAAAGCTGATGCTGCTTTCATGCATTGCACGACCATGAAATCATTTTTTGAGGAAACACTCATAGCAATTCCAGACTTTGTCTTGGATGCACCTGTTGGAGCGCCACCATCTGGTAGTAATGATCCTTTTGGAAACATACATACTTTGTTGCCTCCACCATACGAATCAAGGGAACAAGAGCTACAATATGCTTCGTCTATCAAATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dus

Protein Analysis

108

Amino Acids

11.95

Weight (kDa)

5.51

Isoelectric Point (pI)

56.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 227
AclWI GGATC 1 cut(s) 233
AfiI CCNNNNNNNGG 1 cut(s) 227
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 2 cut(s) 122, 298
AluI AGCT 2 cut(s) 122, 298
AlwI GGATC 1 cut(s) 233
ApeKI GCWGC 2 cut(s) 64, 128
AspLEI GCGC 1 cut(s) 220
AsuHPI GGTGA 1 cut(s) 16
BauI CACGAG 1 cut(s) 46
BbvI GCAGC 2 cut(s) 76, 115
BccI CCATC 1 cut(s) 232
BciT130I CCWGG 1 cut(s) 96
BfoI RGCGCY 1 cut(s) 221
BisI GCNGC 2 cut(s) 65, 129
BlpI GCTNAGC 2 cut(s) 74, 90
BlsI GCNGC 2 cut(s) 66, 130
Bme1390I CCNGG 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 96
BmsI GCATC 2 cut(s) 115, 193
Bpu1102I GCTNAGC 2 cut(s) 74, 90
BsaJI CCNNGG 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 227
Bse3DI GCAATG 1 cut(s) 139
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 227
BseMI GCAATG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 104
BseXI GCAGC 2 cut(s) 76, 115
BslI CCNNNNNNNGG 1 cut(s) 227
BsmI GAATGC 1 cut(s) 20
Bsp143I GATC 1 cut(s) 238
Bsp1720I GCTNAGC 2 cut(s) 74, 90
BspCNI CTCAG 1 cut(s) 103
BspHI TCATGA 1 cut(s) 24
BspPI GGATC 1 cut(s) 233
BsrDI GCAATG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 1 cut(s) 238
BssSI CACGAG 1 cut(s) 46
Bst2BI CACGAG 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 96
BstAPI GCANNNNNTGC 1 cut(s) 70
BstDEI CTNAG 2 cut(s) 74, 90
BstF5I GGATG 1 cut(s) 208
BstH2I RGCGCY 1 cut(s) 221
BstHHI GCGC 1 cut(s) 220
BstKTI GATC 1 cut(s) 241
BstMBI GATC 1 cut(s) 238
BstMWI GCNNNNNNNGC 2 cut(s) 70, 128
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BstV1I GCAGC 2 cut(s) 76, 115
BtsCI GGATG 1 cut(s) 208
CciI TCATGA 1 cut(s) 24
CfoI GCGC 1 cut(s) 220
CviAII CATG 3 cut(s) 25, 136, 151
CviJI RGCY 6 cut(s) 67, 78, 94, 105, 122, 298
CviKI_1 RGCY 6 cut(s) 67, 78, 94, 105, 122, 298
DdeI CTNAG 2 cut(s) 74, 90
DpnI GATC 1 cut(s) 240
DpnII GATC 1 cut(s) 238
EcoRII CCWGG 1 cut(s) 94
EcoT22I ATGCAT 1 cut(s) 141
FaeI CATG 3 cut(s) 28, 139, 154
FatI CATG 3 cut(s) 24, 135, 150
Fnu4HI GCNGC 2 cut(s) 65, 129
FokI GGATG 1 cut(s) 215
Fsp4HI GCNGC 2 cut(s) 65, 129
GlaI GCGC 1 cut(s) 219
GluI GCNGC 2 cut(s) 65, 129
HaeII RGCGCY 1 cut(s) 221
HhaI GCGC 1 cut(s) 220
Hin1II CATG 3 cut(s) 28, 139, 154
Hin6I GCGC 1 cut(s) 218
HinP1I GCGC 1 cut(s) 218
HinfI GANTC 1 cut(s) 281
HphI GGTGA 1 cut(s) 16
Hpy188III TCNNGA 3 cut(s) 25, 46, 188
HpyCH4V TGCA 4 cut(s) 117, 139, 144, 206
HpyF10VI GCNNNNNNNGC 2 cut(s) 70, 128
HpyF3I CTNAG 2 cut(s) 74, 90
Hsp92II CATG 3 cut(s) 28, 139, 154
HspAI GCGC 1 cut(s) 218
Kzo9I GATC 1 cut(s) 238
LmnI GCTCC 1 cut(s) 215
LpnPI CCDG 5 cut(s) 81, 108, 201, 213, 222
Lsp1109I GCAGC 2 cut(s) 76, 115
LweI GCATC 2 cut(s) 115, 193
MalI GATC 1 cut(s) 240
MboI GATC 1 cut(s) 238
MluCI AATT 2 cut(s) 29, 183
MmeI TCCRAC 1 cut(s) 193
MnlI CCTC 2 cut(s) 160, 279
Mph1103I ATGCAT 1 cut(s) 141
MseI TTAA 2 cut(s) 32, 325
MslI CAYNNNNRTG 1 cut(s) 149
MspR9I CCNGG 1 cut(s) 96
Mva1269I GAATGC 1 cut(s) 20
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 2 cut(s) 70, 128
NdeII GATC 1 cut(s) 238
NlaIII CATG 3 cut(s) 28, 139, 154
NsiI ATGCAT 1 cut(s) 141
PagI TCATGA 1 cut(s) 24
PctI GAATGC 1 cut(s) 20
PfeI GAWTC 1 cut(s) 281
PflFI GACNNNGTC 1 cut(s) 194
PflMI CCANNNNNTGG 1 cut(s) 227
PkrI GCNGC 2 cut(s) 66, 130
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PsrI GAACNNNNNNTAC 2 cut(s) 282, 314
PsyI GACNNNGTC 1 cut(s) 194
RseI CAYNNNNRTG 1 cut(s) 149
SaqAI TTAA 2 cut(s) 32, 325
SatI GCNGC 2 cut(s) 65, 129
Sau3AI GATC 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 96
SetI ASST 3 cut(s) 124, 211, 300
SfaNI GCATC 2 cut(s) 115, 193
SmiMI CAYNNNNRTG 1 cut(s) 149
Sse9I AATT 2 cut(s) 29, 183
StyD4I CCNGG 1 cut(s) 94
TasI AATT 2 cut(s) 29, 183
TfiI GAWTC 1 cut(s) 281
Tru1I TTAA 2 cut(s) 32, 325
Tru9I TTAA 2 cut(s) 32, 325
TseI GCWGC 2 cut(s) 64, 128
TspDTI ATGAA 4 cut(s) 13, 41, 124, 167
Tth111I GACNNNGTC 1 cut(s) 194
Van91I CCANNNNNTGG 1 cut(s) 227
Zsp2I ATGCAT 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.