Rh1DG016100

Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
2707928 .. 2708568
641 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG016100.1

Sequence Viewer

Length: 264 bp
ATGGGCGATGTATCACTATTGGTACTACGCCTTTTCTATGCTCAACCTGGGAATAGCCTTTGGAAACGCAAAGCTGATACTGCTTTCATGCATTGCACGACCATGAAATCATTTTTTAAGGAAACACTCGTAGCAATTCCAGACTTTGTCTTGGATGCACCTGTTGGAGCGCCACCATCTGGTAGTAATGATCCTTTTGGAAACATACATATTTTGTTGCCTCCACCATACGGATCAAGGGAACAAGAGCTACAATATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.63

Weight (kDa)

6.02

Isoelectric Point (pI)

72.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 179
AclWI GGATC 2 cut(s) 185, 241
AfaI GTAC 1 cut(s) 24
AfiI CCNNNNNNNGG 2 cut(s) 179, 230
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 2 cut(s) 74, 250
AluI AGCT 2 cut(s) 74, 250
AlwI GGATC 2 cut(s) 185, 241
AspLEI GCGC 1 cut(s) 172
BccI CCATC 1 cut(s) 184
BciT130I CCWGG 1 cut(s) 48
BfoI RGCGCY 1 cut(s) 173
Bme1390I CCNGG 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 47
Bsc4I CCNNNNNNNGG 2 cut(s) 179, 230
Bse3DI GCAATG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 47
BseGI GGATG 1 cut(s) 160
BseLI CCNNNNNNNGG 2 cut(s) 179, 230
BseMI GCAATG 1 cut(s) 91
BslI CCNNNNNNNGG 2 cut(s) 179, 230
Bsp143I GATC 2 cut(s) 190, 233
BspPI GGATC 2 cut(s) 185, 241
BsrDI GCAATG 1 cut(s) 91
BssECI CCNNGG 1 cut(s) 47
BssMI GATC 2 cut(s) 190, 233
Bst2UI CCWGG 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 261
BstF5I GGATG 1 cut(s) 160
BstH2I RGCGCY 1 cut(s) 173
BstHHI GCGC 1 cut(s) 172
BstKTI GATC 2 cut(s) 193, 236
BstMBI GATC 2 cut(s) 190, 233
BstMWI GCNNNNNNNGC 1 cut(s) 80
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BtgZI GCGATG 1 cut(s) 21
BtsCI GGATG 1 cut(s) 160
CfoI GCGC 1 cut(s) 172
Csp6I GTAC 1 cut(s) 23
CviAII CATG 2 cut(s) 88, 103
CviJI RGCY 3 cut(s) 57, 74, 250
CviKI_1 RGCY 3 cut(s) 57, 74, 250
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 1 cut(s) 261
DpnI GATC 2 cut(s) 192, 235
DpnII GATC 2 cut(s) 190, 233
EcoRII CCWGG 1 cut(s) 46
EcoT22I ATGCAT 1 cut(s) 93
FaeI CATG 2 cut(s) 91, 106
FaiI YATR 7 cut(s) 39, 89, 104, 206, 210, 229, 258
FatI CATG 2 cut(s) 87, 102
FokI GGATG 1 cut(s) 167
GlaI GCGC 1 cut(s) 171
HaeII RGCGCY 1 cut(s) 173
HhaI GCGC 1 cut(s) 172
Hin1II CATG 2 cut(s) 91, 106
Hin6I GCGC 1 cut(s) 170
HinP1I GCGC 1 cut(s) 170
Hpy188III TCNNGA 1 cut(s) 140
HpyCH4V TGCA 3 cut(s) 91, 96, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 261
Hsp92II CATG 2 cut(s) 91, 106
HspAI GCGC 1 cut(s) 170
Kzo9I GATC 2 cut(s) 190, 233
LmnI GCTCC 1 cut(s) 167
LpnPI CCDG 5 cut(s) 33, 60, 153, 165, 174
LweI GCATC 1 cut(s) 145
MalI GATC 2 cut(s) 192, 235
MboI GATC 2 cut(s) 190, 233
MluCI AATT 1 cut(s) 135
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 1 cut(s) 231
Mph1103I ATGCAT 1 cut(s) 93
MseI TTAA 1 cut(s) 117
MslI CAYNNNNRTG 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
MwoI GCNNNNNNNGC 1 cut(s) 80
NdeII GATC 2 cut(s) 190, 233
NlaIII CATG 2 cut(s) 91, 106
NsiI ATGCAT 1 cut(s) 93
PflFI GACNNNGTC 1 cut(s) 146
PflMI CCANNNNNTGG 1 cut(s) 179
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PsrI GAACNNNNNNTAC 1 cut(s) 234
PsyI GACNNNGTC 1 cut(s) 146
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 2 cut(s) 190, 233
ScrFI CCNGG 1 cut(s) 48
SetI ASST 4 cut(s) 49, 76, 163, 252
SfaNI GCATC 1 cut(s) 145
SmiMI CAYNNNNRTG 1 cut(s) 101
Sse9I AATT 1 cut(s) 135
StyD4I CCNGG 1 cut(s) 46
TasI AATT 1 cut(s) 135
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 2 cut(s) 76, 119
TspGWI ACGGA 1 cut(s) 246
Tth111I GACNNNGTC 1 cut(s) 146
Van91I CCANNNNNTGG 1 cut(s) 179
Zsp2I ATGCAT 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.