Rh1AG191500
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. RsmB NOP family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
36476908 .. 36489866
12959 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG191500.1

Sequence Viewer

Length: 165 bp
ATGGCATGGAATAATAGTGATCCTAGTTTCAGCTTAAGGGCAAACAGTGGGAAAGGTATTTCAAGAGCTAACCTTGTGACAAAGCTTAATTTATTGAAGATGTCACTCTGGGATCATACTTTGTCTGCAACTAATGCTTTGCGCAGTTTGCTCAATTGGGAATAG

Protein Analysis

54

Amino Acids

6.04

Weight (kDa)

10.27

Isoelectric Point (pI)

39.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 143
AclWI GGATC 2 cut(s) 14, 120
AflII CTTAAG 1 cut(s) 34
AgsI TTSAA 2 cut(s) 63, 97
AluBI AGCT 3 cut(s) 33, 68, 85
AluI AGCT 3 cut(s) 33, 68, 85
AlwI GGATC 2 cut(s) 14, 120
AspLEI GCGC 1 cut(s) 144
BfaI CTAG 1 cut(s) 24
BfrI CTTAAG 1 cut(s) 34
Bsp143I GATC 2 cut(s) 19, 112
BspPI GGATC 2 cut(s) 14, 120
BspTI CTTAAG 1 cut(s) 34
BssMI GATC 2 cut(s) 19, 112
Bst4CI ACNGT 1 cut(s) 47
BstAFI CTTAAG 1 cut(s) 34
BstAPI GCANNNNNTGC 1 cut(s) 134
BstHHI GCGC 1 cut(s) 144
BstKTI GATC 2 cut(s) 22, 115
BstMBI GATC 2 cut(s) 19, 112
BstMWI GCNNNNNNNGC 2 cut(s) 134, 148
BtsIMutI CAGTG 1 cut(s) 52
CfoI GCGC 1 cut(s) 144
CviAII CATG 1 cut(s) 6
CviJI RGCY 3 cut(s) 33, 68, 85
CviKI_1 RGCY 3 cut(s) 33, 68, 85
DpnI GATC 2 cut(s) 21, 114
DpnII GATC 2 cut(s) 19, 112
FaeI CATG 1 cut(s) 9
FaiI YATR 2 cut(s) 7, 117
FatI CATG 1 cut(s) 5
FspBI CTAG 1 cut(s) 24
FspI TGCGCA 1 cut(s) 143
GlaI GCGC 1 cut(s) 143
HhaI GCGC 1 cut(s) 144
Hin1II CATG 1 cut(s) 9
Hin6I GCGC 1 cut(s) 142
HinP1I GCGC 1 cut(s) 142
HindIII AAGCTT 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 63
HpyCH4III ACNGT 1 cut(s) 47
HpyCH4V TGCA 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 2 cut(s) 134, 148
Hsp92II CATG 1 cut(s) 9
HspAI GCGC 1 cut(s) 142
Kzo9I GATC 2 cut(s) 19, 112
LpnPI CCDG 1 cut(s) 94
MaeI CTAG 1 cut(s) 24
MaeIII GTNAC 2 cut(s) 76, 102
MalI GATC 2 cut(s) 21, 114
MboI GATC 2 cut(s) 19, 112
MboII GAAGA 1 cut(s) 109
MfeI CAATTG 1 cut(s) 154
MluCI AATT 2 cut(s) 88, 154
MseI TTAA 2 cut(s) 35, 87
MspCI CTTAAG 1 cut(s) 34
MunI CAATTG 1 cut(s) 154
MwoI GCNNNNNNNGC 2 cut(s) 134, 148
NdeII GATC 2 cut(s) 19, 112
NlaIII CATG 1 cut(s) 9
NmuCI GTSAC 2 cut(s) 76, 102
NsbI TGCGCA 1 cut(s) 143
SaqAI TTAA 2 cut(s) 35, 87
Sau3AI GATC 2 cut(s) 19, 112
SetI ASST 5 cut(s) 35, 58, 70, 75, 87
SgeI CNNG 5 cut(s) 18, 36, 75, 86, 121
SmlI CTYRAG 1 cut(s) 34
SmoI CTYRAG 1 cut(s) 34
Sse9I AATT 2 cut(s) 88, 154
SspMI CTAG 1 cut(s) 24
TaaI ACNGT 1 cut(s) 47
TasI AATT 2 cut(s) 88, 154
Tru1I TTAA 2 cut(s) 35, 87
Tru9I TTAA 2 cut(s) 35, 87
TscAI CASTG 1 cut(s) 52
TseFI GTSAC 2 cut(s) 76, 102
Tsp45I GTSAC 2 cut(s) 76, 102
TspRI CASTG 1 cut(s) 52
Vha464I CTTAAG 1 cut(s) 34
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.