Rh5DG280100

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
34292219 .. 34294464
2246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG280100.1

Sequence Viewer

Length: 234 bp
ATGTCCACCTTGTCCAATACGCTGTGTTTCACTTACTTTAAGACTCTAGGGAAATGGCCAATCGGCGACTTGGCCTTCGGTATTAACTACCTCATGCGTAGGCAGGGAGTGTTCGTCCTGATACAAGTTAGTGTACACGCTGATAAACCTATAAACATGCCTCATGCATATCTTAAACTTTATCTCCCTATCTTTTACAAGTTTCAGATTATAGTGCAAGATTATAAATTATAG

Protein Analysis

77

Amino Acids

9.03

Weight (kDa)

9.56

Isoelectric Point (pI)

25.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lipase3_N PF03893 2 - 43 4.8e-06 Lipase 3 N-terminal region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 225
AcoI YGGCCR 1 cut(s) 56
AfaI GTAC 1 cut(s) 135
AoxI GGCC 2 cut(s) 56, 72
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
BalI TGGCCA 1 cut(s) 58
BfaI CTAG 1 cut(s) 47
BsaXI ACNNNNNCTCC 4 cut(s) 99, 129, 168, 198
BshFI GGCC 2 cut(s) 58, 74
BsnI GGCC 2 cut(s) 58, 74
Bsp1407I TGTACA 1 cut(s) 133
BspANI GGCC 2 cut(s) 58, 74
BsrGI TGTACA 1 cut(s) 133
BstAUI TGTACA 1 cut(s) 133
BstNSI RCATGY 1 cut(s) 160
BsuRI GGCC 2 cut(s) 58, 74
Csp6I GTAC 1 cut(s) 134
CviAII CATG 3 cut(s) 94, 157, 164
CviJI RGCY 2 cut(s) 58, 74
CviKI_1 RGCY 2 cut(s) 58, 74
CviQI GTAC 1 cut(s) 134
EaeI YGGCCR 1 cut(s) 56
EcoT22I ATGCAT 1 cut(s) 169
FaeI CATG 3 cut(s) 97, 160, 167
FaiI YATR 8 cut(s) 95, 152, 158, 165, 169, 212, 225, 232
FatI CATG 3 cut(s) 93, 156, 163
FspBI CTAG 1 cut(s) 47
HaeIII GGCC 2 cut(s) 58, 74
Hin1II CATG 3 cut(s) 97, 160, 167
HinfI GANTC 1 cut(s) 43
Hpy166II GTNNAC 3 cut(s) 6, 134, 136
Hpy188I TCNGA 1 cut(s) 207
Hpy188III TCNNGA 1 cut(s) 118
Hpy8I GTNNAC 3 cut(s) 6, 134, 136
HpyAV CCTTC 1 cut(s) 85
HpyCH4V TGCA 2 cut(s) 167, 217
Hsp92II CATG 3 cut(s) 97, 160, 167
LpnPI CCDG 2 cut(s) 89, 131
MaeI CTAG 1 cut(s) 47
MlsI TGGCCA 1 cut(s) 58
MluCI AATT 1 cut(s) 227
MluNI TGGCCA 1 cut(s) 58
MlyI GAGTC 1 cut(s) 37
MnlI CCTC 2 cut(s) 101, 171
Mox20I TGGCCA 1 cut(s) 58
Mph1103I ATGCAT 1 cut(s) 169
MscI TGGCCA 1 cut(s) 58
MseI TTAA 3 cut(s) 39, 84, 174
Msp20I TGGCCA 1 cut(s) 58
NlaIII CATG 3 cut(s) 97, 160, 167
NsiI ATGCAT 1 cut(s) 169
NspI RCATGY 1 cut(s) 160
PleI GAGTC 1 cut(s) 37
PpsI GAGTC 1 cut(s) 37
PsiI TTATAA 1 cut(s) 225
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
SaqAI TTAA 3 cut(s) 39, 84, 174
SchI GAGTC 1 cut(s) 37
SetI ASST 3 cut(s) 11, 93, 151
Sse9I AATT 1 cut(s) 227
SspMI CTAG 1 cut(s) 47
TasI AATT 1 cut(s) 227
TatI WGTACW 1 cut(s) 133
Tru1I TTAA 3 cut(s) 39, 84, 174
Tru9I TTAA 3 cut(s) 39, 84, 174
XceI RCATGY 1 cut(s) 160
XspI CTAG 1 cut(s) 47
Zsp2I ATGCAT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.