Rh1BG159000

Argonaute

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0001623
Physical Location & Seq
Forward (+)
25792072 .. 25794831
2760 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG159000.1

Sequence Viewer

Length: 327 bp
ATGGATGTGTCCACTACAATGATTGTAAAACCTGGTCCTGTTTTGAATTTCCTCATGGAGAACCAGAATGTCAAAACTCCTTACCAGATTGATTGGATTAAGCTTGGCGGAATCAACTCCTTGCTAATGGTGGAGCATTGTCCTTCTCTGCCCTTGGTATCCAAGTCCCCCACTCTGATTTTAGGGATGGATGTGTCACATGGTTCACCTGGGCGTTCCGATGTGCCTTCTATTGCAGCGGTGACCAAGTTCCAGGAAATGGCCTTTGATTTCTCGTTACCGAGCTGCAGTTCGTACTCAATCACCAAAAGTAGAAATGATTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ArgoL1 ArgoL2 ArgoMid ArgoN PAZ Piwi

Protein Analysis

108

Amino Acids

11.76

Weight (kDa)

6.02

Isoelectric Point (pI)

41.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Piwi PF02171 33 - 85 4.5e-09 Piwi domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 259
AciI CCGC 2 cut(s) 108, 239
AcsI RAATTY 1 cut(s) 46
AfaI GTAC 1 cut(s) 296
AfiI CCNNNNNNNGG 1 cut(s) 259
AgsI TTSAA 1 cut(s) 46
AjnI CCWGG 3 cut(s) 31, 208, 252
AluBI AGCT 2 cut(s) 103, 285
AluI AGCT 2 cut(s) 103, 285
AoxI GGCC 1 cut(s) 261
ApeKI GCWGC 2 cut(s) 236, 285
ApoI RAATTY 1 cut(s) 46
AspS9I GGNCC 1 cut(s) 35
AsuHPI GGTGA 3 cut(s) 198, 253, 295
AvaII GGWCC 1 cut(s) 35
BbvI GCAGC 2 cut(s) 248, 272
BccI CCATC 1 cut(s) 181
BciT130I CCWGG 3 cut(s) 33, 210, 254
BciVI GTATCC 1 cut(s) 169
BfmI CTRYAG 1 cut(s) 286
BfuI GTATCC 1 cut(s) 169
BisI GCNGC 2 cut(s) 237, 286
BlsI GCNGC 2 cut(s) 238, 287
Bme1390I CCNGG 3 cut(s) 33, 210, 254
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BmrFI CCNGG 3 cut(s) 33, 210, 254
BsaJI CCNNGG 2 cut(s) 153, 209
Bsc4I CCNNNNNNNGG 1 cut(s) 259
BseBI CCWGG 3 cut(s) 33, 210, 254
BseDI CCNNGG 2 cut(s) 153, 209
BseGI GGATG 3 cut(s) 10, 192, 196
BseLI CCNNNNNNNGG 1 cut(s) 259
BseXI GCAGC 2 cut(s) 248, 272
BshFI GGCC 1 cut(s) 263
BslFI GGGAC 1 cut(s) 151
BslI CCNNNNNNNGG 1 cut(s) 259
BsmFI GGGAC 1 cut(s) 151
BsnI GGCC 1 cut(s) 263
BspACI CCGC 2 cut(s) 108, 239
BspANI GGCC 1 cut(s) 263
BspMAI CTGCAG 1 cut(s) 290
BssECI CCNNGG 2 cut(s) 153, 209
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 3 cut(s) 33, 210, 254
BstEII GGTNACC 1 cut(s) 241
BstF5I GGATG 3 cut(s) 10, 192, 196
BstNI CCWGG 3 cut(s) 33, 210, 254
BstPI GGTNACC 1 cut(s) 241
BstSCI CCNGG 3 cut(s) 31, 208, 252
BstSFI CTRYAG 1 cut(s) 286
BstV1I GCAGC 2 cut(s) 248, 272
BsuI GTATCC 1 cut(s) 169
BsuRI GGCC 1 cut(s) 263
BtsCI GGATG 3 cut(s) 10, 192, 196
Cfr13I GGNCC 1 cut(s) 35
CsiI ACCWGGT 1 cut(s) 31
Csp6I GTAC 1 cut(s) 295
CviAII CATG 2 cut(s) 55, 200
CviJI RGCY 3 cut(s) 103, 263, 285
CviKI_1 RGCY 3 cut(s) 103, 263, 285
CviQI GTAC 1 cut(s) 295
EciI GGCGGA 1 cut(s) 123
Eco130I CCWWGG 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 35
Eco91I GGTNACC 1 cut(s) 241
EcoO65I GGTNACC 1 cut(s) 241
EcoRII CCWGG 3 cut(s) 31, 208, 252
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 2 cut(s) 58, 203
FaiI YATR 2 cut(s) 56, 201
FaqI GGGAC 1 cut(s) 151
FatI CATG 2 cut(s) 54, 199
Fnu4HI GCNGC 2 cut(s) 237, 286
FokI GGATG 3 cut(s) 17, 199, 203
Fsp4HI GCNGC 2 cut(s) 237, 286
GluI GCNGC 2 cut(s) 237, 286
HaeIII GGCC 1 cut(s) 263
Hin1II CATG 2 cut(s) 58, 203
HindIII AAGCTT 1 cut(s) 101
HinfI GANTC 1 cut(s) 111
HphI GGTGA 3 cut(s) 198, 253, 295
Hpy166II GTNNAC 2 cut(s) 12, 206
Hpy188I TCNGA 2 cut(s) 177, 220
Hpy8I GTNNAC 2 cut(s) 12, 206
HpyAV CCTTC 2 cut(s) 153, 237
HpyCH4V TGCA 2 cut(s) 236, 288
Hsp92II CATG 2 cut(s) 58, 203
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 9 cut(s) 18, 45, 51, 77, 98, 195, 222, 239, 266
Lsp1109I GCAGC 2 cut(s) 248, 272
MabI ACCWGGT 1 cut(s) 31
MaeIII GTNAC 3 cut(s) 195, 241, 276
MluCI AATT 1 cut(s) 46
MnlI CCTC 1 cut(s) 62
MseI TTAA 1 cut(s) 99
MslI CAYNNNNRTG 1 cut(s) 17
MspA1I CMGCKG 1 cut(s) 239
MspR9I CCNGG 3 cut(s) 33, 210, 254
MvaI CCWGG 3 cut(s) 33, 210, 254
NlaIII CATG 2 cut(s) 58, 203
NmuCI GTSAC 2 cut(s) 195, 241
PfeI GAWTC 1 cut(s) 111
PflMI CCANNNNNTGG 1 cut(s) 259
PfoI TCCNGGA 1 cut(s) 252
PkrI GCNGC 2 cut(s) 238, 287
Psp6I CCWGG 3 cut(s) 31, 208, 252
PspEI GGTNACC 1 cut(s) 241
PspGI CCWGG 3 cut(s) 31, 208, 252
PspPI GGNCC 1 cut(s) 35
PstI CTGCAG 1 cut(s) 290
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
RseI CAYNNNNRTG 1 cut(s) 17
SaqAI TTAA 1 cut(s) 99
SatI GCNGC 2 cut(s) 237, 286
Sau96I GGNCC 1 cut(s) 35
ScrFI CCNGG 3 cut(s) 33, 210, 254
SetI ASST 4 cut(s) 34, 105, 211, 287
SexAI ACCWGGT 1 cut(s) 31
SfcI CTRYAG 1 cut(s) 286
SinI GGWCC 1 cut(s) 35
SmiMI CAYNNNNRTG 1 cut(s) 17
Sse9I AATT 1 cut(s) 46
SsiI CCGC 2 cut(s) 108, 239
StyD4I CCNGG 3 cut(s) 31, 208, 252
StyI CCWWGG 1 cut(s) 153
TasI AATT 1 cut(s) 46
TfiI GAWTC 1 cut(s) 111
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TseFI GTSAC 2 cut(s) 195, 241
TseI GCWGC 2 cut(s) 236, 285
Tsp45I GTSAC 2 cut(s) 195, 241
Van91I CCANNNNNTGG 1 cut(s) 259
VpaK11BI GGWCC 1 cut(s) 35
XapI RAATTY 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.