Rh3DG104300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0001849
Physical Location & Seq
Reverse (-)
8414006 .. 8414320
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG104300.1

Sequence Viewer

Length: 315 bp
ATGGTACTCTTTGTCGATGAAGAAATCGAGGTCAGGCTCACGCACCTGGAAGCGTGTGACGGCAGAGCGCACCCAAGAGTCGACGTGGGAGGTGTAGTTCTGGTAGAAGATGAAAGAGAGGCGGAAGGTTTTGATTGGAGAATTGGGGCGGAGAATGAGAGCGCAGTTGACGAACTCGGTGAAGCCGTAGCTCGTGATGGGGAGGGGTTTGGCGTCGTTGACCGGGAAGAGGTGGTAGGAGAAGTCGAGGAAGGGGAGACGGGACTAGAGGGATCGCCATTGGCGGAAGACGAGCAAGTTGTGGATGGCCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.24

Weight (kDa)

4.05

Isoelectric Point (pI)

28.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 81
AciI CCGC 3 cut(s) 122, 149, 284
AclWI GGATC 1 cut(s) 280
AcyI GRCGYC 1 cut(s) 213
AfaI GTAC 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 229
AjiI CACGTC 1 cut(s) 85
AjnI CCWGG 1 cut(s) 45
AloI GAACNNNNNNTCC 2 cut(s) 81, 113
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
Alw26I GTCTC 1 cut(s) 251
AlwI GGATC 1 cut(s) 280
AoxI GGCC 1 cut(s) 307
AspLEI GCGC 2 cut(s) 70, 164
AsuC2I CCSGG 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 191
BauI CACGAG 1 cut(s) 192
BbsI GAAGAC 1 cut(s) 294
BccI CCATC 2 cut(s) 191, 299
BceAI ACGGC 2 cut(s) 76, 170
BciT130I CCWGG 1 cut(s) 47
BcnI CCSGG 1 cut(s) 224
BcoDI GTCTC 1 cut(s) 251
BfaI CTAG 1 cut(s) 266
Bme1390I CCNGG 2 cut(s) 47, 224
BmgBI CACGTC 1 cut(s) 85
BmrFI CCNGG 2 cut(s) 47, 224
BpiI GAAGAC 1 cut(s) 294
BpuMI CCSGG 1 cut(s) 224
BsaHI GRCGYC 1 cut(s) 213
BsaXI ACNNNNNCTCC 2 cut(s) 81, 111
Bsc4I CCNNNNNNNGG 1 cut(s) 229
BseBI CCWGG 1 cut(s) 47
BseGI GGATG 1 cut(s) 310
BseLI CCNNNNNNNGG 1 cut(s) 229
BshFI GGCC 1 cut(s) 309
BsiSI CCGG 1 cut(s) 223
BslFI GGGAC 1 cut(s) 276
BslI CCNNNNNNNGG 1 cut(s) 229
BsmAI GTCTC 1 cut(s) 251
BsmBI CGTCTC 1 cut(s) 251
BsmFI GGGAC 1 cut(s) 276
BsnI GGCC 1 cut(s) 309
Bsp143I GATC 1 cut(s) 272
BspACI CCGC 3 cut(s) 122, 149, 284
BspANI GGCC 1 cut(s) 309
BspPI GGATC 1 cut(s) 280
BssMI GATC 1 cut(s) 272
BssNI GRCGYC 1 cut(s) 213
BssSI CACGAG 1 cut(s) 192
Bst2BI CACGAG 1 cut(s) 192
Bst2UI CCWGG 1 cut(s) 47
Bst6I CTCTTC 1 cut(s) 222
BstACI GRCGYC 1 cut(s) 213
BstF5I GGATG 1 cut(s) 310
BstHHI GCGC 2 cut(s) 70, 164
BstKTI GATC 1 cut(s) 275
BstMAI GTCTC 1 cut(s) 251
BstMBI GATC 1 cut(s) 272
BstNI CCWGG 1 cut(s) 47
BstSCI CCNGG 2 cut(s) 45, 222
BstV2I GAAGAC 1 cut(s) 294
BsuRI GGCC 1 cut(s) 309
BtrI CACGTC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 310
CfoI GCGC 2 cut(s) 70, 164
CseI GACGC 1 cut(s) 202
Csp6I GTAC 1 cut(s) 5
CviJI RGCY 4 cut(s) 37, 185, 191, 309
CviKI_1 RGCY 4 cut(s) 37, 185, 191, 309
CviQI GTAC 1 cut(s) 5
DpnI GATC 1 cut(s) 274
DpnII GATC 1 cut(s) 272
Eam1104I CTCTTC 1 cut(s) 222
EarI CTCTTC 1 cut(s) 222
EciI GGCGGA 3 cut(s) 137, 164, 299
EcoRII CCWGG 1 cut(s) 45
Esp3I CGTCTC 1 cut(s) 251
FaqI GGGAC 1 cut(s) 276
FblI GTMKAC 1 cut(s) 81
FspBI CTAG 1 cut(s) 266
GlaI GCGC 2 cut(s) 69, 163
HaeIII GGCC 1 cut(s) 309
HapII CCGG 1 cut(s) 223
HgaI GACGC 1 cut(s) 202
HhaI GCGC 2 cut(s) 70, 164
Hin1I GRCGYC 1 cut(s) 213
Hin6I GCGC 2 cut(s) 68, 162
HinP1I GCGC 2 cut(s) 68, 162
HincII GTYRAC 3 cut(s) 82, 169, 220
HindII GTYRAC 3 cut(s) 82, 169, 220
HinfI GANTC 1 cut(s) 78
HpaII CCGG 1 cut(s) 223
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 3 cut(s) 82, 169, 220
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 3 cut(s) 82, 169, 220
Hpy99I CGWCG 2 cut(s) 86, 218
HpyAV CCTTC 2 cut(s) 119, 245
HpyCH4IV ACGT 1 cut(s) 84
HpySE526I ACGT 1 cut(s) 84
Hsp92I GRCGYC 1 cut(s) 213
HspAI GCGC 2 cut(s) 68, 162
Kzo9I GATC 1 cut(s) 272
LpnPI CCDG 5 cut(s) 19, 32, 59, 86, 236
MaeI CTAG 1 cut(s) 266
MaeII ACGT 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 56
MalI GATC 1 cut(s) 274
MboI GATC 1 cut(s) 272
MboII GAAGA 4 cut(s) 32, 119, 239, 299
MluCI AATT 1 cut(s) 141
MlyI GAGTC 1 cut(s) 87
MnlI CCTC 7 cut(s) 22, 83, 112, 196, 223, 241, 262
MspI CCGG 1 cut(s) 223
MspR9I CCNGG 2 cut(s) 47, 224
MvaI CCWGG 1 cut(s) 47
NciI CCSGG 1 cut(s) 224
NdeII GATC 1 cut(s) 272
NmuCI GTSAC 1 cut(s) 56
PcsI WCGNNNNNNNCGW 1 cut(s) 183
PleI GAGTC 1 cut(s) 86
PpsI GAGTC 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
SalI GTCGAC 1 cut(s) 80
Sau3AI GATC 1 cut(s) 272
SchI GAGTC 1 cut(s) 87
ScrFI CCNGG 2 cut(s) 47, 224
SetI ASST 7 cut(s) 33, 48, 87, 94, 130, 193, 234
Sse9I AATT 1 cut(s) 141
SsiI CCGC 3 cut(s) 122, 149, 284
SspMI CTAG 1 cut(s) 266
StyD4I CCNGG 2 cut(s) 45, 222
TaiI ACGT 1 cut(s) 87
TaqI TCGA 4 cut(s) 15, 27, 81, 246
TasI AATT 1 cut(s) 141
TseFI GTSAC 1 cut(s) 56
Tsp45I GTSAC 1 cut(s) 56
TspDTI ATGAA 2 cut(s) 33, 126
XmiI GTMKAC 1 cut(s) 81
XspI CTAG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.