Rh4AG241200

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
54792457 .. 54799779
7323 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG241200.1

Sequence Viewer

Length: 276 bp
ATGCATGTGCCAACCATTATCAGGGATGCACTTCCCAAGAGCTTTGAAGCTTTGAATCAACATGTTGTTGCTGTGGTGGTGGATCCAATTCAAAGTGTGAAGAGGAAGGTGGTCATTGATGCCTTCCGCCTTATCAACCCACAGACTATGATGCTCGTTCAAGAACCTCGGCAGACCACATCTAATCTGGGCCATCTTAATAAACCATCTATTCAAGACTCTGTCCTTTACACTATTCTTGATTATGCCTTGAAGGATCAAGAAATGTGTGCATGA

Protein Analysis

91

Amino Acids

10.28

Weight (kDa)

6.82

Isoelectric Point (pI)

45.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 127
AclWI GGATC 3 cut(s) 77, 90, 264
AfiI CCNNNNNNNGG 1 cut(s) 21
AflIII ACRYGT 1 cut(s) 61
AgsI TTSAA 6 cut(s) 47, 55, 92, 161, 215, 253
AluBI AGCT 2 cut(s) 42, 50
AluI AGCT 2 cut(s) 42, 50
AlwI GGATC 3 cut(s) 77, 90, 264
AoxI GGCC 1 cut(s) 190
AspS9I GGNCC 1 cut(s) 190
BamHI GGATCC 1 cut(s) 82
BccI CCATC 2 cut(s) 201, 214
BmgT120I GGNCC 1 cut(s) 190
BmiI GGNNCC 1 cut(s) 84
BmsI GCATC 3 cut(s) 16, 109, 141
BsaJI CCNNGG 1 cut(s) 167
Bsc4I CCNNNNNNNGG 1 cut(s) 21
BseDI CCNNGG 1 cut(s) 167
BseGI GGATG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 21
BshFI GGCC 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 21
BsnI GGCC 1 cut(s) 192
Bsp143I GATC 2 cut(s) 82, 256
BspACI CCGC 1 cut(s) 127
BspANI GGCC 1 cut(s) 192
BspLI GGNNCC 1 cut(s) 84
BspPI GGATC 3 cut(s) 77, 90, 264
BssECI CCNNGG 1 cut(s) 167
BssMI GATC 2 cut(s) 82, 256
Bst6I CTCTTC 1 cut(s) 95
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 2 cut(s) 85, 259
BstMBI GATC 2 cut(s) 82, 256
BstNSI RCATGY 2 cut(s) 8, 65
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BsuRI GGCC 1 cut(s) 192
BtsCI GGATG 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 190
CviAII CATG 3 cut(s) 5, 62, 273
CviJI RGCY 3 cut(s) 42, 50, 192
CviKI_1 RGCY 3 cut(s) 42, 50, 192
DpnI GATC 2 cut(s) 84, 258
DpnII GATC 2 cut(s) 82, 256
Eam1104I CTCTTC 1 cut(s) 95
EarI CTCTTC 1 cut(s) 95
EciI GGCGGA 1 cut(s) 116
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 8, 65, 276
FaiI YATR 5 cut(s) 6, 63, 149, 246, 274
FatI CATG 3 cut(s) 4, 61, 272
FokI GGATG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 192
Hin1II CATG 3 cut(s) 8, 65, 276
HindIII AAGCTT 1 cut(s) 48
HinfI GANTC 2 cut(s) 55, 218
Hpy188III TCNNGA 4 cut(s) 161, 215, 239, 260
HpyAV CCTTC 3 cut(s) 100, 133, 247
HpyCH4V TGCA 3 cut(s) 4, 29, 272
Hsp92II CATG 3 cut(s) 8, 65, 276
Kzo9I GATC 2 cut(s) 82, 256
LpnPI CCDG 2 cut(s) 7, 173
LweI GCATC 3 cut(s) 16, 109, 141
MalI GATC 2 cut(s) 84, 258
MboI GATC 2 cut(s) 82, 256
MboII GAAGA 1 cut(s) 112
MflI RGATCY 1 cut(s) 82
MluCI AATT 1 cut(s) 87
MlyI GAGTC 1 cut(s) 212
MnlI CCTC 2 cut(s) 96, 177
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 198
NdeII GATC 2 cut(s) 82, 256
NlaIII CATG 3 cut(s) 8, 65, 276
NlaIV GGNNCC 1 cut(s) 84
NmeAIII GCCGAG 1 cut(s) 148
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 2 cut(s) 8, 65
PciI ACATGT 1 cut(s) 61
PfeI GAWTC 1 cut(s) 55
PflFI GACNNNGTC 1 cut(s) 221
PleI GAGTC 1 cut(s) 212
PpsI GAGTC 1 cut(s) 212
PscI ACATGT 1 cut(s) 61
PspN4I GGNNCC 1 cut(s) 84
PspPI GGNCC 1 cut(s) 190
PsuI RGATCY 1 cut(s) 82
PsyI GACNNNGTC 1 cut(s) 221
SaqAI TTAA 1 cut(s) 198
Sau3AI GATC 2 cut(s) 82, 256
Sau96I GGNCC 1 cut(s) 190
SchI GAGTC 1 cut(s) 212
SetI ASST 4 cut(s) 44, 52, 111, 169
SfaNI GCATC 3 cut(s) 16, 109, 141
Sse9I AATT 1 cut(s) 87
SsiI CCGC 1 cut(s) 127
TasI AATT 1 cut(s) 87
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
Tth111I GACNNNGTC 1 cut(s) 221
XceI RCATGY 2 cut(s) 8, 65
XcmI CCANNNNNNNNNTGG 1 cut(s) 184
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.