Rh7AG243800

Maintenance of mitochondrial structure and function

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0001418
Physical Location & Seq
Forward (+)
23994033 .. 23994329
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG243800.1

Sequence Viewer

Length: 297 bp
ATGCTTGGCATGCTTAAGCAGGCCGGGCGACCGGAGATGGTTGTTGGGAGGTACCATTCTCACCCTGGATTTGGTTGCTGGCTATCTGGTGTAGACATGAATACACAGCAAAGCTTTGAGGCTTTGAACAAACGTGCTGTGGCTGTGGTGGTGGATCCGATTCAAAGTGTCAAGGGCAAGGTGGTTATGGATGCGTTCCGCCTTATCAACCCCCAAACTATGATGTTTCATCAAGAACCGAGGCAGACCACATCCAATCTAGGGCTTCTCAATAAGCCATCCATTCATAGCGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03050 ko05169 map03050 map05169
Pfam Domains
Protein Families
JAB MitMem_reg

Protein Analysis

98

Amino Acids

10.91

Weight (kDa)

9.43

Isoelectric Point (pI)

38.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
JAB PF01398 1 - 43 2.7e-10 JAB1/Mov34/MPN/PAD-1 ubiquitin protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 51
AccB1I GGYRCC 1 cut(s) 51
AccI GTMKAC 1 cut(s) 93
AciI CCGC 1 cut(s) 199
AclWI GGATC 2 cut(s) 149, 162
AfaI GTAC 1 cut(s) 53
AfiI CCNNNNNNNGG 2 cut(s) 71, 261
AflII CTTAAG 1 cut(s) 14
AgsI TTSAA 2 cut(s) 127, 164
AjnI CCWGG 1 cut(s) 64
AluBI AGCT 1 cut(s) 114
AluI AGCT 1 cut(s) 114
AlwI GGATC 2 cut(s) 149, 162
AoxI GGCC 1 cut(s) 21
Asp718I GGTACC 1 cut(s) 51
AsuC2I CCSGG 1 cut(s) 25
AsuHPI GGTGA 1 cut(s) 53
BamHI GGATCC 1 cut(s) 154
BanI GGYRCC 1 cut(s) 51
BccI CCATC 2 cut(s) 31, 286
BciT130I CCWGG 1 cut(s) 66
BcnI CCSGG 1 cut(s) 25
BfaI CTAG 1 cut(s) 260
BfrI CTTAAG 1 cut(s) 14
Bme1390I CCNGG 2 cut(s) 25, 66
BmiI GGNNCC 2 cut(s) 53, 156
BmrFI CCNGG 2 cut(s) 25, 66
BmsI GCATC 1 cut(s) 181
BpuMI CCSGG 1 cut(s) 25
BsaJI CCNNGG 2 cut(s) 64, 239
BsaWI WCCGGW 1 cut(s) 31
Bsc4I CCNNNNNNNGG 2 cut(s) 71, 261
BseBI CCWGG 1 cut(s) 66
BseDI CCNNGG 2 cut(s) 64, 239
BseGI GGATG 3 cut(s) 196, 251, 278
BseLI CCNNNNNNNGG 2 cut(s) 71, 261
Bsh1285I CGRYCG 1 cut(s) 32
BshFI GGCC 1 cut(s) 23
BshNI GGYRCC 1 cut(s) 51
BsiEI CGRYCG 1 cut(s) 32
BsiSI CCGG 2 cut(s) 24, 32
BslI CCNNNNNNNGG 2 cut(s) 71, 261
BsnI GGCC 1 cut(s) 23
Bsp143I GATC 1 cut(s) 154
BspACI CCGC 1 cut(s) 199
BspANI GGCC 1 cut(s) 23
BspLI GGNNCC 2 cut(s) 53, 156
BspPI GGATC 2 cut(s) 149, 162
BspT107I GGYRCC 1 cut(s) 51
BspTI CTTAAG 1 cut(s) 14
BssECI CCNNGG 2 cut(s) 64, 239
BssMI GATC 1 cut(s) 154
Bst2UI CCWGG 1 cut(s) 66
BstAFI CTTAAG 1 cut(s) 14
BstC8I GCNNGC 3 cut(s) 11, 21, 80
BstF5I GGATG 3 cut(s) 196, 251, 278
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMCI CGRYCG 1 cut(s) 32
BstMWI GCNNNNNNNGC 2 cut(s) 10, 25
BstNI CCWGG 1 cut(s) 66
BstNSI RCATGY 1 cut(s) 13
BstSCI CCNGG 2 cut(s) 23, 64
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BsuRI GGCC 1 cut(s) 23
BtsCI GGATG 3 cut(s) 196, 251, 278
Cac8I GCNNGC 3 cut(s) 11, 21, 80
Csp6I GTAC 1 cut(s) 52
CviAII CATG 2 cut(s) 10, 97
CviJI RGCY 7 cut(s) 23, 82, 114, 122, 143, 265, 277
CviKI_1 RGCY 7 cut(s) 23, 82, 114, 122, 143, 265, 277
CviQI GTAC 1 cut(s) 52
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
EciI GGCGGA 1 cut(s) 188
EcoRII CCWGG 1 cut(s) 64
FaeI CATG 2 cut(s) 13, 100
FaiI YATR 5 cut(s) 11, 98, 188, 221, 288
FatI CATG 2 cut(s) 9, 96
FblI GTMKAC 1 cut(s) 93
FokI GGATG 3 cut(s) 203, 238, 265
FspBI CTAG 1 cut(s) 260
HaeIII GGCC 1 cut(s) 23
HapII CCGG 2 cut(s) 24, 32
Hin1II CATG 2 cut(s) 13, 100
HindIII AAGCTT 1 cut(s) 112
HinfI GANTC 1 cut(s) 160
HpaII CCGG 2 cut(s) 24, 32
HphI GGTGA 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 233
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 25
HpySE526I ACGT 1 cut(s) 133
Hsp92II CATG 2 cut(s) 13, 100
KpnI GGTACC 1 cut(s) 55
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 7 cut(s) 5, 37, 45, 51, 64, 72, 78
LweI GCATC 1 cut(s) 181
MaeI CTAG 1 cut(s) 260
MaeII ACGT 1 cut(s) 133
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MflI RGATCY 1 cut(s) 154
MnlI CCTC 3 cut(s) 42, 112, 234
MseI TTAA 2 cut(s) 15, 295
MspCI CTTAAG 1 cut(s) 14
MspI CCGG 2 cut(s) 24, 32
MspR9I CCNGG 2 cut(s) 25, 66
MvaI CCWGG 1 cut(s) 66
MwoI GCNNNNNNNGC 2 cut(s) 10, 25
NciI CCSGG 1 cut(s) 25
NdeII GATC 1 cut(s) 154
NlaIII CATG 2 cut(s) 13, 100
NlaIV GGNNCC 2 cut(s) 53, 156
NspI RCATGY 1 cut(s) 13
PaeI GCATGC 1 cut(s) 13
PfeI GAWTC 1 cut(s) 160
Psp6I CCWGG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 64
PspN4I GGNNCC 2 cut(s) 53, 156
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
SaqAI TTAA 2 cut(s) 15, 295
Sau3AI GATC 1 cut(s) 154
ScrFI CCNGG 2 cut(s) 25, 66
SetI ASST 4 cut(s) 53, 116, 136, 183
SfaNI GCATC 1 cut(s) 181
SmlI CTYRAG 1 cut(s) 14
SmoI CTYRAG 1 cut(s) 14
SphI GCATGC 1 cut(s) 13
SsiI CCGC 1 cut(s) 199
SspMI CTAG 1 cut(s) 260
StyD4I CCNGG 2 cut(s) 23, 64
TaiI ACGT 1 cut(s) 136
TfiI GAWTC 1 cut(s) 160
Tru1I TTAA 2 cut(s) 15, 295
Tru9I TTAA 2 cut(s) 15, 295
TspDTI ATGAA 3 cut(s) 113, 218, 275
Vha464I CTTAAG 1 cut(s) 14
XceI RCATGY 1 cut(s) 13
XcmI CCANNNNNNNNNTGG 1 cut(s) 62
XmiI GTMKAC 1 cut(s) 93
XspI CTAG 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.