FvH4_6g08721

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
5193606 .. 5194705
1100 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g08721.t1

Sequence Viewer

Length: 309 bp
ATGGCTTTGGCAGCAACTAGTGTTCATGCCCGCTTAGACCTATTTGCCCAGCTGCTTACCTCTAACAACCAACTAGACACTGAATGTCAGAAAATTCCATATCAACTGTGCGACGGTGTCTGCAACAGTTGCGTTTGCGACAGGCGTGTTCCACAGTATGCAGAGTGCATTTGCACAAAGTGGAAACCAGTTGATGAAGAACTCCAGAAATCTGAAAAATTATCTGCAGAACCGGAAGTAGTCGCCAAACCAGTTGCAAAATCAGGGGGAGGGCTTTCTTCCATACCCCGAGTGCATAGAAAAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.25

Weight (kDa)

7.55

Isoelectric Point (pI)

55.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 31
AcsI RAATTY 1 cut(s) 93
AdeI CACNNNGTG 1 cut(s) 180
AhlI ACTAGT 1 cut(s) 17
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
Ama87I CYCGRG 1 cut(s) 288
ApeKI GCWGC 2 cut(s) 11, 52
ApoI RAATTY 1 cut(s) 93
AvaI CYCGRG 1 cut(s) 288
BbvI GCAGC 2 cut(s) 23, 39
BcuI ACTAGT 1 cut(s) 17
BfaI CTAG 2 cut(s) 18, 74
BfmI CTRYAG 1 cut(s) 225
BisI GCNGC 2 cut(s) 12, 53
BlsI GCNGC 2 cut(s) 13, 54
BmeT110I CYCGRG 1 cut(s) 288
BpmI CTGGAG 1 cut(s) 188
BsaWI WCCGGW 1 cut(s) 232
Bse1I ACTGG 2 cut(s) 188, 251
BseNI ACTGG 2 cut(s) 188, 251
BseXI GCAGC 2 cut(s) 23, 39
BseYI CCCAGC 1 cut(s) 48
BsiHKCI CYCGRG 1 cut(s) 288
BsiSI CCGG 1 cut(s) 233
BsoBI CYCGRG 1 cut(s) 288
BspACI CCGC 1 cut(s) 31
BspMAI CTGCAG 1 cut(s) 229
BsrI ACTGG 2 cut(s) 188, 251
Bst4CI ACNGT 4 cut(s) 108, 116, 128, 156
BstAPI GCANNNNNTGC 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 34
BstMWI GCNNNNNNNGC 2 cut(s) 11, 129
BstSFI CTRYAG 1 cut(s) 225
BstV1I GCAGC 2 cut(s) 23, 39
BtsIMutI CAGTG 1 cut(s) 78
Cac8I GCNNGC 1 cut(s) 31
CviAII CATG 1 cut(s) 26
CviJI RGCY 3 cut(s) 5, 52, 274
CviKI_1 RGCY 3 cut(s) 5, 52, 274
DdeI CTNAG 1 cut(s) 34
DraIII CACNNNGTG 1 cut(s) 180
Eco88I CYCGRG 1 cut(s) 288
FaeI CATG 1 cut(s) 29
FaiI YATR 5 cut(s) 27, 100, 159, 284, 297
FatI CATG 1 cut(s) 25
FauI CCCGC 1 cut(s) 38
Fnu4HI GCNGC 2 cut(s) 12, 53
Fsp4HI GCNGC 2 cut(s) 12, 53
FspBI CTAG 2 cut(s) 18, 74
GluI GCNGC 2 cut(s) 12, 53
GsaI CCCAGC 1 cut(s) 52
GsuI CTGGAG 1 cut(s) 188
HapII CCGG 1 cut(s) 233
Hin1II CATG 1 cut(s) 29
HpaII CCGG 1 cut(s) 233
Hpy188I TCNGA 2 cut(s) 90, 214
Hpy188III TCNNGA 1 cut(s) 205
Hpy99I CGWCG 1 cut(s) 116
HpyCH4III ACNGT 4 cut(s) 108, 116, 128, 156
HpyCH4V TGCA 7 cut(s) 123, 161, 168, 174, 227, 257, 295
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 129
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 1 cut(s) 29
LpnPI CCDG 7 cut(s) 62, 127, 201, 218, 246, 249, 264
Lsp1109I GCAGC 2 cut(s) 23, 39
MaeI CTAG 2 cut(s) 18, 74
MboII GAAGA 2 cut(s) 209, 270
MluCI AATT 2 cut(s) 93, 218
MnlI CCTC 2 cut(s) 70, 263
MspA1I CMGCKG 1 cut(s) 52
MspI CCGG 1 cut(s) 233
MwoI GCNNNNNNNGC 2 cut(s) 11, 129
NlaIII CATG 1 cut(s) 29
PflFI GACNNNGTC 1 cut(s) 116
PkrI GCNGC 2 cut(s) 13, 54
PspFI CCCAGC 1 cut(s) 48
PstI CTGCAG 1 cut(s) 229
PsyI GACNNNGTC 1 cut(s) 116
PvuII CAGCTG 1 cut(s) 52
SatI GCNGC 2 cut(s) 12, 53
SetI ASST 3 cut(s) 42, 54, 62
SfcI CTRYAG 1 cut(s) 225
SpeI ACTAGT 1 cut(s) 17
Sse9I AATT 2 cut(s) 93, 218
SsiI CCGC 1 cut(s) 31
SspMI CTAG 2 cut(s) 18, 74
TaaI ACNGT 4 cut(s) 108, 116, 128, 156
TasI AATT 2 cut(s) 93, 218
TscAI CASTG 1 cut(s) 85
TseI GCWGC 2 cut(s) 11, 52
TspDTI ATGAA 2 cut(s) 14, 210
TspRI CASTG 1 cut(s) 85
Tth111I GACNNNGTC 1 cut(s) 116
XapI RAATTY 1 cut(s) 93
XspI CTAG 2 cut(s) 18, 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.