Rmu_sc0001782.1_g000056

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001782.1
Physical Location & Seq
Forward (+)
269085 .. 271026
1942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001782.1_g000056.1.cds

Sequence Viewer

Length: 747 bp
atgttgcttgccatggctttggcagcaacaaatactcatgctcgcttagatctatttggccaccagctgcttacctccaagagccaaccagatcccaattatgaagaagcagagatgttcaaatcagcaaccactaaagaggccgaaaaattgatgaaggcagcagctgtagtccaagaagagaaaccgagtagcagcatagtgaaagcagatacaattccatattcagaatgccaggaaagctgcgagtatacatgtgtttgcacacttatttggccacctgaactatcacagtgcatctgtgctggatcaagcaaattatcaaccactaatgcggccgaaaatttgcttaagccagctgttgtagtccaagaagagaaaccgagtagcagcatagtgaaagcagatacaattccatattcagaatgccaggaaagctgcgagtatacatgtgtttgcacacttatttggccacctgaactatcacagtgcatctgtgctggatcaagcaaattatcaaccactaatgcggccgaaaatttgcttaagccagctgttgtagtccaagaagagaaaccgagtagcagcatagtgaaagcagatacaattccatattcagaatgccaggaaagctgcgagtatacatgtgtttgcacacttatttggccacctgaactatcacagtgcatttgtgttggatcaagcaaattatcaaccactaaagcggccggtaatgaactaatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

248

Amino Acids

26.77

Weight (kDa)

4.65

Isoelectric Point (pI)

41.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 3 cut(s) 251, 446, 641
AciI CCGC 3 cut(s) 335, 530, 725
AclWI GGATC 4 cut(s) 86, 316, 511, 706
AcoI YGGCCR 7 cut(s) 58, 275, 336, 470, 531, 665, 726
AcsI RAATTY 2 cut(s) 343, 538
AflII CTTAAG 2 cut(s) 350, 545
AflIII ACRYGT 3 cut(s) 254, 449, 644
AgsI TTSAA 1 cut(s) 121
AjnI CCWGG 3 cut(s) 234, 429, 624
AluBI AGCT 7 cut(s) 67, 167, 243, 359, 438, 554, 633
AluI AGCT 7 cut(s) 67, 167, 243, 359, 438, 554, 633
AlwI GGATC 4 cut(s) 86, 316, 511, 706
AlwNI CAGNNNCTG 1 cut(s) 167
AoxI GGCC 8 cut(s) 58, 141, 275, 336, 470, 531, 665, 726
ApoI RAATTY 2 cut(s) 343, 538
BalI TGGCCA 4 cut(s) 60, 277, 472, 667
BciT130I CCWGG 3 cut(s) 236, 431, 626
BfmI CTRYAG 1 cut(s) 168
BfrI CTTAAG 2 cut(s) 350, 545
BglII AGATCT 1 cut(s) 49
Bme1390I CCNGG 3 cut(s) 236, 431, 626
BmrFI CCNGG 3 cut(s) 236, 431, 626
BmsI GCATC 2 cut(s) 306, 501
BsaJI CCNNGG 1 cut(s) 12
Bse118I RCCGGY 1 cut(s) 728
BseBI CCWGG 3 cut(s) 236, 431, 626
BseDI CCNNGG 1 cut(s) 12
BseX3I CGGCCG 3 cut(s) 336, 531, 726
Bsh1285I CGRYCG 3 cut(s) 339, 534, 729
BshFI GGCC 8 cut(s) 60, 143, 277, 338, 472, 533, 667, 728
BsiEI CGRYCG 3 cut(s) 339, 534, 729
BsiSI CCGG 1 cut(s) 729
BsmI GAATGC 3 cut(s) 236, 431, 626
BsnI GGCC 8 cut(s) 60, 143, 277, 338, 472, 533, 667, 728
Bsp143I GATC 5 cut(s) 49, 91, 308, 503, 698
Bsp19I CCATGG 1 cut(s) 12
BspACI CCGC 3 cut(s) 335, 530, 725
BspANI GGCC 8 cut(s) 60, 143, 277, 338, 472, 533, 667, 728
BspPI GGATC 4 cut(s) 86, 316, 511, 706
BspTI CTTAAG 2 cut(s) 350, 545
BsrFI RCCGGY 1 cut(s) 728
BssAI RCCGGY 1 cut(s) 728
BssECI CCNNGG 1 cut(s) 12
BssMI GATC 5 cut(s) 49, 91, 308, 503, 698
BssNAI GTATAC 3 cut(s) 252, 447, 642
BssT1I CCWWGG 1 cut(s) 12
Bst1107I GTATAC 3 cut(s) 252, 447, 642
Bst2UI CCWGG 3 cut(s) 236, 431, 626
Bst4CI ACNGT 3 cut(s) 294, 489, 684
Bst6I CTCTTC 3 cut(s) 174, 369, 564
BstAFI CTTAAG 2 cut(s) 350, 545
BstC8I GCNNGC 4 cut(s) 9, 43, 357, 552
BstDEI CTNAG 1 cut(s) 46
BstDSI CCRYGG 1 cut(s) 12
BstKTI GATC 5 cut(s) 52, 94, 311, 506, 701
BstMBI GATC 5 cut(s) 49, 91, 308, 503, 698
BstMCI CGRYCG 3 cut(s) 339, 534, 729
BstMWI GCNNNNNNNGC 4 cut(s) 23, 240, 435, 630
BstNI CCWGG 3 cut(s) 236, 431, 626
BstNSI RCATGY 3 cut(s) 258, 453, 648
BstSCI CCNGG 3 cut(s) 234, 429, 624
BstSFI CTRYAG 1 cut(s) 168
BstX2I RGATCY 2 cut(s) 49, 91
BstXI CCANNNNNNTGG 1 cut(s) 19
BstYI RGATCY 2 cut(s) 49, 91
BstZ17I GTATAC 3 cut(s) 252, 447, 642
BstZI CGGCCG 3 cut(s) 336, 531, 726
BsuRI GGCC 8 cut(s) 60, 143, 277, 338, 472, 533, 667, 728
BtgI CCRYGG 1 cut(s) 12
BtsIMutI CAGTG 3 cut(s) 299, 494, 689
Cac8I GCNNGC 4 cut(s) 9, 43, 357, 552
CaiI CAGNNNCTG 1 cut(s) 167
Cfr10I RCCGGY 1 cut(s) 728
CviAII CATG 5 cut(s) 13, 38, 255, 450, 645
DdeI CTNAG 1 cut(s) 46
DpnI GATC 5 cut(s) 51, 93, 310, 505, 700
DpnII GATC 5 cut(s) 49, 91, 308, 503, 698
EaeI YGGCCR 7 cut(s) 58, 275, 336, 470, 531, 665, 726
EagI CGGCCG 3 cut(s) 336, 531, 726
Eam1104I CTCTTC 3 cut(s) 174, 369, 564
EarI CTCTTC 3 cut(s) 174, 369, 564
EclXI CGGCCG 3 cut(s) 336, 531, 726
Eco130I CCWWGG 1 cut(s) 12
Eco52I CGGCCG 3 cut(s) 336, 531, 726
EcoRII CCWGG 3 cut(s) 234, 429, 624
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 5 cut(s) 16, 41, 258, 453, 648
FatI CATG 5 cut(s) 12, 37, 254, 449, 644
FblI GTMKAC 3 cut(s) 251, 446, 641
HaeIII GGCC 8 cut(s) 60, 143, 277, 338, 472, 533, 667, 728
HapII CCGG 1 cut(s) 729
Hin1II CATG 5 cut(s) 16, 41, 258, 453, 648
HpaII CCGG 1 cut(s) 729
Hpy166II GTNNAC 3 cut(s) 252, 447, 642
Hpy188I TCNGA 3 cut(s) 229, 424, 619
Hpy8I GTNNAC 3 cut(s) 252, 447, 642
HpyAV CCTTC 1 cut(s) 151
HpyCH4III ACNGT 3 cut(s) 294, 489, 684
HpyCH4V TGCA 6 cut(s) 264, 297, 459, 492, 654, 687
HpyF10VI GCNNNNNNNGC 4 cut(s) 23, 240, 435, 630
HpyF3I CTNAG 1 cut(s) 46
Hsp92II CATG 5 cut(s) 16, 41, 258, 453, 648
Kzo9I GATC 5 cut(s) 49, 91, 308, 503, 698
LweI GCATC 2 cut(s) 306, 501
MalI GATC 5 cut(s) 51, 93, 310, 505, 700
MboI GATC 5 cut(s) 49, 91, 308, 503, 698
MboII GAAGA 4 cut(s) 116, 191, 386, 581
MflI RGATCY 2 cut(s) 49, 91
MlsI TGGCCA 4 cut(s) 60, 277, 472, 667
MluNI TGGCCA 4 cut(s) 60, 277, 472, 667
MmeI TCCRAC 1 cut(s) 676
MnlI CCTC 2 cut(s) 85, 133
Mox20I TGGCCA 4 cut(s) 60, 277, 472, 667
MscI TGGCCA 4 cut(s) 60, 277, 472, 667
MseI TTAA 2 cut(s) 351, 546
Msp20I TGGCCA 4 cut(s) 60, 277, 472, 667
MspA1I CMGCKG 4 cut(s) 67, 167, 359, 554
MspCI CTTAAG 2 cut(s) 350, 545
MspI CCGG 1 cut(s) 729
MspR9I CCNGG 3 cut(s) 236, 431, 626
Mva1269I GAATGC 3 cut(s) 236, 431, 626
MvaI CCWGG 3 cut(s) 236, 431, 626
MwoI GCNNNNNNNGC 4 cut(s) 23, 240, 435, 630
NcoI CCATGG 1 cut(s) 12
NdeII GATC 5 cut(s) 49, 91, 308, 503, 698
NlaIII CATG 5 cut(s) 16, 41, 258, 453, 648
NspI RCATGY 3 cut(s) 258, 453, 648
PciI ACATGT 3 cut(s) 254, 449, 644
PctI GAATGC 3 cut(s) 236, 431, 626
PscI ACATGT 3 cut(s) 254, 449, 644
Psp6I CCWGG 3 cut(s) 234, 429, 624
PspGI CCWGG 3 cut(s) 234, 429, 624
PstNI CAGNNNCTG 1 cut(s) 167
PsuI RGATCY 2 cut(s) 49, 91
PvuII CAGCTG 4 cut(s) 67, 167, 359, 554
SaqAI TTAA 2 cut(s) 351, 546
Sau3AI GATC 5 cut(s) 49, 91, 308, 503, 698
ScrFI CCNGG 3 cut(s) 236, 431, 626
SfaNI GCATC 2 cut(s) 306, 501
SfcI CTRYAG 1 cut(s) 168
SmlI CTYRAG 2 cut(s) 350, 545
SmoI CTYRAG 2 cut(s) 350, 545
SsiI CCGC 3 cut(s) 335, 530, 725
StyD4I CCNGG 3 cut(s) 234, 429, 624
StyI CCWWGG 1 cut(s) 12
TaaI ACNGT 3 cut(s) 294, 489, 684
TauI GCSGC 3 cut(s) 338, 533, 728
Tru1I TTAA 2 cut(s) 351, 546
Tru9I TTAA 2 cut(s) 351, 546
TscAI CASTG 3 cut(s) 299, 494, 689
TspDTI ATGAA 2 cut(s) 117, 170
TspRI CASTG 3 cut(s) 299, 494, 689
Vha464I CTTAAG 2 cut(s) 350, 545
XapI RAATTY 2 cut(s) 343, 538
XceI RCATGY 3 cut(s) 258, 453, 648
XmiI GTMKAC 3 cut(s) 251, 446, 641
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.