MD08G1149700.v1.1

Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
15143205 .. 15143601
397 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1149700.v1.1.491

Sequence Viewer

Length: 228 bp
ATGATGATAGTTGGTGATGAATACATAATCATTGGATCTGCGAACATAAATCAAAAGTCAATGGATGGGGCAAGGGACTCTAAGATTGCTATAGGAGAATTCCAACCTAACCATTTAGCTTCCACAATCCCAGCCAGGGCCCAGATGTATGCTTTCAGACTAGCACTATGGTATGAGCACCTCAAAGTGGATGACAACTCCTTCTGGCATCTAGAATCTTTGGAATGA

Protein Analysis

76

Amino Acids

8.57

Weight (kDa)

5.17

Isoelectric Point (pI)

25.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 43
AcsI RAATTY 1 cut(s) 98
AfiI CCNNNNNNNGG 2 cut(s) 136, 187
AjnI CCWGG 1 cut(s) 134
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
Alw21I GWGCWC 1 cut(s) 180
AlwI GGATC 1 cut(s) 43
AoxI GGCC 1 cut(s) 138
ApaI GGGCCC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 98
AspS9I GGNCC 2 cut(s) 138, 139
AsuHPI GGTGA 1 cut(s) 26
BaeGI GKGCMC 1 cut(s) 142
BanII GRGCYC 1 cut(s) 142
Bbv12I GWGCWC 1 cut(s) 180
BccI CCATC 1 cut(s) 59
BciT130I CCWGG 1 cut(s) 136
BfaI CTAG 2 cut(s) 161, 212
BfmI CTRYAG 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 136
BmgT120I GGNCC 2 cut(s) 138, 139
BmiI GGNNCC 1 cut(s) 140
BmrFI CCNGG 1 cut(s) 136
BmsI GCATC 1 cut(s) 217
BsaJI CCNNGG 1 cut(s) 135
Bsc4I CCNNNNNNNGG 2 cut(s) 136, 187
BseBI CCWGG 1 cut(s) 136
BseDI CCNNGG 1 cut(s) 135
BseGI GGATG 2 cut(s) 70, 196
BseLI CCNNNNNNNGG 2 cut(s) 136, 187
BseSI GKGCMC 1 cut(s) 142
BseYI CCCAGC 1 cut(s) 130
BshFI GGCC 1 cut(s) 140
BsiHKAI GWGCWC 1 cut(s) 180
BslFI GGGAC 1 cut(s) 89
BslI CCNNNNNNNGG 2 cut(s) 136, 187
BsmFI GGGAC 1 cut(s) 89
BsnI GGCC 1 cut(s) 140
Bsp120I GGGCCC 1 cut(s) 138
Bsp1286I GDGCHC 2 cut(s) 142, 180
Bsp143I GATC 1 cut(s) 35
BspANI GGCC 1 cut(s) 140
BspLI GGNNCC 1 cut(s) 140
BspPI GGATC 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 136
BstDEI CTNAG 1 cut(s) 81
BstF5I GGATG 2 cut(s) 70, 196
BstKTI GATC 1 cut(s) 38
BstMBI GATC 1 cut(s) 35
BstNI CCWGG 1 cut(s) 136
BstSCI CCNGG 1 cut(s) 134
BstSFI CTRYAG 1 cut(s) 90
BstSLI GKGCMC 1 cut(s) 142
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
BsuRI GGCC 1 cut(s) 140
BtsCI GGATG 2 cut(s) 70, 196
Cfr13I GGNCC 2 cut(s) 138, 139
CviJI RGCY 3 cut(s) 119, 134, 140
CviKI_1 RGCY 3 cut(s) 119, 134, 140
DdeI CTNAG 1 cut(s) 81
DpnI GATC 1 cut(s) 37
DpnII GATC 1 cut(s) 35
Eco24I GRGCYC 1 cut(s) 142
EcoO109I RGGNCCY 1 cut(s) 138
EcoRI GAATTC 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 134
EcoT38I GRGCYC 1 cut(s) 142
FaiI YATR 6 cut(s) 26, 47, 92, 150, 169, 174
FaqI GGGAC 1 cut(s) 89
FokI GGATG 2 cut(s) 77, 203
FriOI GRGCYC 1 cut(s) 142
FspBI CTAG 2 cut(s) 161, 212
GsaI CCCAGC 1 cut(s) 134
HaeIII GGCC 1 cut(s) 140
HinfI GANTC 2 cut(s) 77, 215
HphI GGTGA 1 cut(s) 26
Hpy188I TCNGA 1 cut(s) 158
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 211
HpyF3I CTNAG 1 cut(s) 81
Kzo9I GATC 1 cut(s) 35
LpnPI CCDG 5 cut(s) 121, 144, 148, 155, 190
LweI GCATC 1 cut(s) 217
MaeI CTAG 2 cut(s) 161, 212
MalI GATC 1 cut(s) 37
MboI GATC 1 cut(s) 35
MflI RGATCY 1 cut(s) 35
MhlI GDGCHC 2 cut(s) 142, 180
MluCI AATT 1 cut(s) 98
MlyI GAGTC 1 cut(s) 71
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 1 cut(s) 191
MspR9I CCNGG 1 cut(s) 136
MvaI CCWGG 1 cut(s) 136
NdeII GATC 1 cut(s) 35
NlaIV GGNNCC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 215
PleI GAGTC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 71
Psp6I CCWGG 1 cut(s) 134
PspFI CCCAGC 1 cut(s) 130
PspGI CCWGG 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 140
PspOMI GGGCCC 1 cut(s) 138
PspPI GGNCC 2 cut(s) 138, 139
PsuI RGATCY 1 cut(s) 35
Sau3AI GATC 1 cut(s) 35
Sau96I GGNCC 2 cut(s) 138, 139
SchI GAGTC 1 cut(s) 71
ScrFI CCNGG 1 cut(s) 136
SduI GDGCHC 2 cut(s) 142, 180
SetI ASST 3 cut(s) 109, 121, 183
SfaNI GCATC 1 cut(s) 217
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 8 cut(s) 84, 143, 147, 148, 154, 173, 217, 224
Sse9I AATT 1 cut(s) 98
SspMI CTAG 2 cut(s) 161, 212
StyD4I CCNGG 1 cut(s) 134
TasI AATT 1 cut(s) 98
TfiI GAWTC 1 cut(s) 215
TspDTI ATGAA 1 cut(s) 33
XapI RAATTY 1 cut(s) 98
XbaI TCTAGA 1 cut(s) 211
XspI CTAG 2 cut(s) 161, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.